Rh2BG125800

Belongs to the GDA1 CD39 NTPase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
10756456 .. 10758824
2369 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG125800.1

Sequence Viewer

Length: 249 bp
ATGATGTTGCAAAAAGGAAAAGAAAAATGTTTCTATCAACCCTGCAGTATAGGATCAACTTTCACACCAAAGCTTCAGGGGAAGTTTCTGGCCACAGAAAATTTCTTTCACACATCTAAGTTCTTTGGACGAGTTCTTGATTCTCCAAGGAATAGTGATAATTGCACTCCTATTATGGGAACGTGGAACTTTAACAAGGTCAAGCTGAAGAAATATTTGGAAAGGAGGGAAGCTGATGGAGGGACTTGA

Protein Analysis

82

Amino Acids

9.45

Weight (kDa)

9.63

Isoelectric Point (pI)

34.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 61
AcoI YGGCCR 1 cut(s) 90
AcsI RAATTY 1 cut(s) 100
AcuI CTGAAG 2 cut(s) 59, 227
AfiI CCNNNNNNNGG 1 cut(s) 176
AjuI GAANNNNNNNTTGG 2 cut(s) 200, 232
AluBI AGCT 3 cut(s) 73, 205, 233
AluI AGCT 3 cut(s) 73, 205, 233
AlwI GGATC 1 cut(s) 61
AoxI GGCC 1 cut(s) 90
ApoI RAATTY 1 cut(s) 100
BalI TGGCCA 1 cut(s) 92
BccI CCATC 1 cut(s) 230
BfmI CTRYAG 1 cut(s) 43
BsaJI CCNNGG 1 cut(s) 146
Bsc4I CCNNNNNNNGG 1 cut(s) 176
BseDI CCNNGG 1 cut(s) 146
BseLI CCNNNNNNNGG 1 cut(s) 176
BshFI GGCC 1 cut(s) 92
BslI CCNNNNNNNGG 1 cut(s) 176
BsnI GGCC 1 cut(s) 92
Bsp143I GATC 1 cut(s) 53
BspANI GGCC 1 cut(s) 92
BspMAI CTGCAG 1 cut(s) 47
BspPI GGATC 1 cut(s) 61
BssECI CCNNGG 1 cut(s) 146
BssMI GATC 1 cut(s) 53
BssT1I CCWWGG 1 cut(s) 146
BstDEI CTNAG 1 cut(s) 117
BstKTI GATC 1 cut(s) 56
BstMBI GATC 1 cut(s) 53
BstSFI CTRYAG 1 cut(s) 43
BsuRI GGCC 1 cut(s) 92
CviJI RGCY 4 cut(s) 73, 92, 205, 233
CviKI_1 RGCY 4 cut(s) 73, 92, 205, 233
DdeI CTNAG 1 cut(s) 117
DpnI GATC 1 cut(s) 55
DpnII GATC 1 cut(s) 53
EaeI YGGCCR 1 cut(s) 90
Eco130I CCWWGG 1 cut(s) 146
Eco57I CTGAAG 2 cut(s) 59, 227
EcoT14I CCWWGG 1 cut(s) 146
ErhI CCWWGG 1 cut(s) 146
FaiI YATR 2 cut(s) 50, 176
HaeIII GGCC 1 cut(s) 92
HindIII AAGCTT 1 cut(s) 71
HinfI GANTC 1 cut(s) 140
Hpy188III TCNNGA 1 cut(s) 137
HpyCH4IV ACGT 1 cut(s) 182
HpyCH4V TGCA 3 cut(s) 10, 45, 165
HpyF3I CTNAG 1 cut(s) 117
HpySE526I ACGT 1 cut(s) 182
Kzo9I GATC 1 cut(s) 53
LpnPI CCDG 3 cut(s) 55, 62, 74
MaeII ACGT 1 cut(s) 182
MalI GATC 1 cut(s) 55
MboI GATC 1 cut(s) 53
MboII GAAGA 1 cut(s) 220
MlsI TGGCCA 1 cut(s) 92
MluCI AATT 2 cut(s) 100, 160
MluNI TGGCCA 1 cut(s) 92
MnlI CCTC 2 cut(s) 219, 233
Mox20I TGGCCA 1 cut(s) 92
MscI TGGCCA 1 cut(s) 92
MseI TTAA 1 cut(s) 192
Msp20I TGGCCA 1 cut(s) 92
NdeII GATC 1 cut(s) 53
PfeI GAWTC 1 cut(s) 140
PstI CTGCAG 1 cut(s) 47
SaqAI TTAA 1 cut(s) 192
Sau3AI GATC 1 cut(s) 53
SetI ASST 5 cut(s) 75, 185, 201, 207, 235
SfcI CTRYAG 1 cut(s) 43
SgeI CNNG 9 cut(s) 54, 89, 101, 143, 149, 159, 195, 208, 214
Sse9I AATT 2 cut(s) 100, 160
SspI AATATT 1 cut(s) 215
StyI CCWWGG 1 cut(s) 146
TaiI ACGT 1 cut(s) 185
TasI AATT 2 cut(s) 100, 160
TfiI GAWTC 1 cut(s) 140
Tru1I TTAA 1 cut(s) 192
Tru9I TTAA 1 cut(s) 192
XapI RAATTY 1 cut(s) 100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.