Rh7CG204100

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Reverse (-)
18133619 .. 18136529
2911 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG204100.1

Sequence Viewer

Length: 276 bp
ATGGCCGTGAGGATGTTAACCTTTGAATTGGCTACATTCTTGCATTCGTTTGAGTGGCGATTGCCCAATGACACGAAGCTTGACCTTTCAGAAAAATTTGGGCTTATGGTGAAGAAGATGGCTCCATTGTTTGCCATTCCAACACCCAGGGTGTCGAGTCAAGATGTTTGCAAAAATGATATAAGATCAAGCACAAGGAAGTGTTTATGGACGGAGAGAATGCACAAAGAGGTTAAGACGCCGACAAATGTGTTCACGGATGGAATGAGTGCATGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

10.51

Weight (kDa)

9.39

Isoelectric Point (pI)

49.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 95
AcyI GRCGYC 1 cut(s) 239
AgsI TTSAA 1 cut(s) 26
AjnI CCWGG 1 cut(s) 146
AluBI AGCT 1 cut(s) 79
AluI AGCT 1 cut(s) 79
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 1 cut(s) 95
AsuHPI GGTGA 1 cut(s) 121
BccI CCATC 2 cut(s) 112, 254
BciT130I CCWGG 1 cut(s) 148
Bme1390I CCNGG 1 cut(s) 148
BmiI GGNNCC 1 cut(s) 123
BmrFI CCNGG 1 cut(s) 148
BsaHI GRCGYC 1 cut(s) 239
BsaJI CCNNGG 2 cut(s) 146, 147
BseBI CCWGG 1 cut(s) 148
BseDI CCNNGG 2 cut(s) 146, 147
BseGI GGATG 2 cut(s) 18, 265
BshFI GGCC 1 cut(s) 5
BsmI GAATGC 2 cut(s) 43, 225
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 1 cut(s) 185
BspANI GGCC 1 cut(s) 5
BspLI GGNNCC 1 cut(s) 123
BssECI CCNNGG 2 cut(s) 146, 147
BssMI GATC 1 cut(s) 185
BssNI GRCGYC 1 cut(s) 239
Bst2UI CCWGG 1 cut(s) 148
BstACI GRCGYC 1 cut(s) 239
BstF5I GGATG 2 cut(s) 18, 265
BstKTI GATC 1 cut(s) 188
BstMBI GATC 1 cut(s) 185
BstNI CCWGG 1 cut(s) 148
BstSCI CCNGG 1 cut(s) 146
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 2 cut(s) 18, 265
CseI GACGC 1 cut(s) 247
CviAII CATG 1 cut(s) 273
CviJI RGCY 5 cut(s) 5, 32, 79, 103, 122
CviKI_1 RGCY 5 cut(s) 5, 32, 79, 103, 122
DpnI GATC 1 cut(s) 187
DpnII GATC 1 cut(s) 185
EaeI YGGCCR 1 cut(s) 3
EcoRII CCWGG 1 cut(s) 146
FaeI CATG 1 cut(s) 276
FaiI YATR 4 cut(s) 107, 182, 208, 274
FatI CATG 1 cut(s) 272
FokI GGATG 2 cut(s) 25, 272
HaeIII GGCC 1 cut(s) 5
HgaI GACGC 1 cut(s) 247
Hin1I GRCGYC 1 cut(s) 239
Hin1II CATG 1 cut(s) 276
HincII GTYRAC 1 cut(s) 18
HindII GTYRAC 1 cut(s) 18
HindIII AAGCTT 1 cut(s) 77
HinfI GANTC 1 cut(s) 157
HpaI GTTAAC 1 cut(s) 18
HphI GGTGA 1 cut(s) 121
Hpy166II GTNNAC 2 cut(s) 18, 255
Hpy188I TCNGA 1 cut(s) 91
Hpy188III TCNNGA 1 cut(s) 161
Hpy8I GTNNAC 2 cut(s) 18, 255
HpyCH4V TGCA 4 cut(s) 43, 171, 223, 272
Hsp92I GRCGYC 1 cut(s) 239
Hsp92II CATG 1 cut(s) 276
KspAI GTTAAC 1 cut(s) 18
Kzo9I GATC 1 cut(s) 185
LmnI GCTCC 1 cut(s) 127
LpnPI CCDG 2 cut(s) 133, 160
MalI GATC 1 cut(s) 187
MboI GATC 1 cut(s) 185
MboII GAAGA 2 cut(s) 124, 127
MluCI AATT 2 cut(s) 26, 95
MlyI GAGTC 1 cut(s) 166
MmeI TCCRAC 1 cut(s) 164
MnlI CCTC 2 cut(s) 3, 223
MseI TTAA 2 cut(s) 17, 234
MspR9I CCNGG 1 cut(s) 148
Mva1269I GAATGC 2 cut(s) 43, 225
MvaI CCWGG 1 cut(s) 148
NdeII GATC 1 cut(s) 185
NlaIII CATG 1 cut(s) 276
NlaIV GGNNCC 1 cut(s) 123
PasI CCCWGGG 1 cut(s) 147
PctI GAATGC 2 cut(s) 43, 225
PleI GAGTC 1 cut(s) 165
PpsI GAGTC 1 cut(s) 165
Psp6I CCWGG 1 cut(s) 146
PspGI CCWGG 1 cut(s) 146
PspN4I GGNNCC 1 cut(s) 123
SaqAI TTAA 2 cut(s) 17, 234
Sau3AI GATC 1 cut(s) 185
SchI GAGTC 1 cut(s) 166
ScrFI CCNGG 1 cut(s) 148
SetI ASST 4 cut(s) 23, 81, 87, 234
Sse9I AATT 2 cut(s) 26, 95
StyD4I CCNGG 1 cut(s) 146
TaqI TCGA 1 cut(s) 155
TasI AATT 2 cut(s) 26, 95
Tru1I TTAA 2 cut(s) 17, 234
Tru9I TTAA 2 cut(s) 17, 234
TspGWI ACGGA 2 cut(s) 227, 272
XapI RAATTY 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.