Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0028511.1

Orthogroup ID

OG0002656

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1833

Gene Structure 1833 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0028511.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1658 bp

acctgagatttacaggtggtagggttcctgatcaagctggtaaacaaagttcattccagggtaaagttatctcctcacctgctggtcgagccagcacaaagggtattccacttactgcgagtcccatgataccaatttcatcaccgctttggagcattcctacccctgcttgtgaggcccctcaatataatgttctgccgagaggttcggtaatggattatcagcaggcccatactccattgcatcctttccaaacatcacccataaggaacattgttggacaaaattcctcgtggatgtctcagtccccgtttcggggtccctgggttccctctccacagtcatctgcagctgaaaccagtattcgtttctcagcatttcctagtacagagtcagtgctgctgactcctgtaaaagaaacaacttcatcacaagtatccagtataaagcatgcctcctcggttgttactggtcaaactgggggtacaaccagtgtttttgcaggggtttctccactgcttgactcaaagaaagtgggagtagcatcacctggcgagccttcatctcaacctaagtctagaaaaagaaaaaagatctcagattctaaggaacttggtccgattagtttgcagcctcaatctgaacctgagtcagctataaccctggctgttactagtagtgtatctacatctgttgtagtcactgccccaagtacctttgtgtctaaggccatgccagaaaaattggctatgtcggtatcctctgatcaactcaagaaagcagatcttggtttggagcagagggcaactttatcaaaagagactcttagtaaagctaaggaggctaggcaacaagcagaggaagcttctgctcatgctgctgcagctgttggtcacagtcaagaaatatggagtcagttggataagcagaaacattccggattgacatcagatgccgaaaccaaattagcttctgctgctgttgctgtagctgccgccgctgctgttgcaaaagcagcagctgcagctgccaatgttgcggcaaatgctgcattgcaagcagtactgatggctgaggaagcctatgggaatcaaagcgaaagtatgatagatttgagtactgatggagtgaatgcattgggattggctgctccaggatctgtttttagggctgaggatggaacaaacagttcaagttcaatcctttttgctgctagagaggctgctagaaggagggttgaagctgcatctgcagcctcaaagcgagctgaaaatatggacgccatagtaaaagctgctgagctagctgcagaagctgtatcacaagctggaacagttgttgctatgggtgatcctgtgcctttgagcgacttggtaaaagctggtcctgagggttattggaaagcaccccaagtatcttcagagactgttaagaaatcaaatgacggaatgagggaacaatcaaatttttccactgttggagaagattcagataaggaagaaacactgatcactgccactaagaaatcgcctacagtcagtgaaagggttactgagattataaagtctgctttgcccactgctgggaatgatcttggaaaaactgcagtagcgtccaaagatagctgcatctttgagggttctcaagtagaggtataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Agenet

Protein Analysis

551

Amino Acids

57.02

Weight (kDa)

7.19

Isoelectric Point (pI)

53.93

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002656)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G17330 AT4G17330 AT4G17330
fragaria_vesca	FvH4_5g19090 FvH4_5g19090 FvH4_5g19090
malus_domestica	MD04G1062800.v1.1 MD06G1057100.v1.1
prunus_persica	Prupe.5G068000_v2.0.a1 Prupe.5G068000_v2.0.a1 Prupe.5G068000_v2.0.a1 Prupe.5G068000_v2.0.a1 Prupe.5G068000_v2.0.a1 Prupe.5G068000_v2.0.a1 Prupe.5G068000_v2.0.a1 Prupe.5G068000_v2.0.a1
pyrus_communis	pycom04g05620 pycom04g05630 pycom04g05650 pycom06g04780 pycom06g04790
rosa_chinensis	RchiOBHm_Chr7g0203541
rosa_laevigata	RLG00000003521
rosa_multiflora	Rmu_co8304519.1_g000001 Rmu_co8320585.1_g000001 Rmu_sc0007812.1_g000001 Rmu_sc0010675.1_g000010 Rmu_sc0021549.1_g000001 Rmu_sc0028511.1_g000001 Rmu_ssc0000362.1_g000008
rosa_roxburghii	Rroxscaffold_3G00253720
rosa_rugosa	Rorug07G0076800 Rorug07G0076800 Rorug07G0076800 Rorug07G0076800
rosa_samantha	Rh7AG206400 Rh7BG206000 Rh7CG218900 Rh7DG213600
rosa_wichuraiana	Rw7G018020

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	1561
AarI	CACCTGC	1 cut(s)	87
Acc36I	ACCTGC	1 cut(s)	87
AccIII	TCCGGA	1 cut(s)	937
AciI	CCGC	4 cut(s)	145, 995, 998, 1039
AclWI	GGATC	2 cut(s)	1164, 1345
AcsI	RAATTY	2 cut(s)	285, 1464
AcuI	CTGAAG	1 cut(s)	1403
AcyI	GRCGYC	1 cut(s)	1280
AfaI	GTAC	5 cut(s)	387, 486, 714, 1064, 1119
AfiI	CCNNNNNNNGG	5 cut(s)	314, 315, 316, 1582, 1583
AgsI	TTSAA	3 cut(s)	1193, 1199, 1240
AhlI	ACTAGT	1 cut(s)	673
AjnI	CCWGG	5 cut(s)	56, 322, 549, 662, 1152
Alw26I	GTCTC	3 cut(s)	305, 814, 1417
AlwI	GGATC	2 cut(s)	1164, 1345
AlwNI	CAGNNNCTG	4 cut(s)	1021, 1159, 1315, 1426
Aor13HI	TCCGGA	1 cut(s)	937
AoxI	GGCC	3 cut(s)	176, 227, 728
ApoI	RAATTY	2 cut(s)	285, 1464
AspS9I	GGNCC	5 cut(s)	177, 228, 319, 616, 1384
AsuHPI	GGTGA	5 cut(s)	68, 134, 251, 539, 1360
AsuNHI	GCTAGC	1 cut(s)	1302
AvaII	GGWCC	3 cut(s)	319, 616, 1384
AxyI	CCTNAGG	1 cut(s)	1388
BauI	CACGAG	1 cut(s)	291
BbvCI	CCTCAGC	2 cut(s)	1073, 1172
BccI	CCATC	3 cut(s)	1062, 1117, 1171
BcgI	CGANNNNNNTGC	2 cut(s)	609, 643
BciT130I	CCWGG	5 cut(s)	58, 324, 551, 664, 1154
BciVI	GTATCC	2 cut(s)	447, 768
BclI	TGATCA	3 cut(s)	30, 765, 1508
BcoDI	GTCTC	3 cut(s)	305, 814, 1417
BcuI	ACTAGT	1 cut(s)	673
BfaI	CTAG	7 cut(s)	383, 578, 674, 845, 1214, 1226, 1303
BfmI	CTRYAG	8 cut(s)	347, 881, 986, 1022, 1250, 1307, 1532, 1604
BfuAI	ACCTGC	1 cut(s)	87
BfuI	GTATCC	2 cut(s)	447, 768
BglII	AGATCT	2 cut(s)	593, 783
BlpI	GCTNAGC	1 cut(s)	1298
BmcAI	AGTACT	2 cut(s)	1064, 1119
Bme1390I	CCNGG	5 cut(s)	58, 324, 551, 664, 1154
Bme18I	GGWCC	3 cut(s)	319, 616, 1384
BmgT120I	GGNCC	5 cut(s)	177, 228, 319, 616, 1384
BmiI	GGNNCC	5 cut(s)	26, 179, 320, 321, 329
BmrFI	CCNGG	5 cut(s)	58, 324, 551, 664, 1154
BmrI	ACTGGG	1 cut(s)	488
BmsI	GCATC	5 cut(s)	252, 553, 942, 1255, 1637
BmtI	GCTAGC	1 cut(s)	1306
BmuI	ACTGGG	1 cut(s)	488
BpmI	CTGGAG	1 cut(s)	1136
Bpu10I	CCTNAGC	3 cut(s)	836, 1073, 1172
Bpu1102I	GCTNAGC	1 cut(s)	1298
BpuEI	CTTGAG	2 cut(s)	757, 1628
BsaBI	GATNNNNATC	1 cut(s)	945
BsaHI	GRCGYC	1 cut(s)	1280
BsaJI	CCNNGG	5 cut(s)	57, 322, 323, 458, 662
BsaWI	WCCGGW	1 cut(s)	937
Bsc4I	CCNNNNNNNGG	5 cut(s)	314, 315, 316, 1582, 1583
Bse1I	ACTGG	5 cut(s)	359, 440, 474, 483, 491
Bse21I	CCTNAGG	1 cut(s)	1388
Bse3DI	GCAATG	2 cut(s)	238, 1051
Bse8I	GATNNNNATC	1 cut(s)	945
BseAI	TCCGGA	1 cut(s)	937
BseBI	CCWGG	5 cut(s)	58, 324, 551, 664, 1154
BseDI	CCNNGG	5 cut(s)	57, 322, 323, 458, 662
BseGI	GGATG	3 cut(s)	243, 302, 1182
BseJI	GATNNNNATC	1 cut(s)	945
BseLI	CCNNNNNNNGG	5 cut(s)	314, 315, 316, 1582, 1583
BseMI	GCAATG	2 cut(s)	238, 1051
BseMII	CTCAG	9 cut(s)	316, 386, 611, 638, 1064, 1163, 1289, 1379, 1544
BseNI	ACTGG	5 cut(s)	359, 440, 474, 483, 491
BseRI	GAGGAG	2 cut(s)	63, 447
BseYI	CCCAGC	1 cut(s)	1582
BshFI	GGCC	3 cut(s)	178, 229, 730
BsiSI	CCGG	1 cut(s)	938
BslFI	GGGAC	3 cut(s)	107, 291, 305
BslI	CCNNNNNNNGG	5 cut(s)	314, 315, 316, 1582, 1583
BsmAI	GTCTC	3 cut(s)	305, 814, 1417
BsmFI	GGGAC	3 cut(s)	107, 291, 305
BsmI	GAATGC	2 cut(s)	155, 1137
BsnI	GGCC	3 cut(s)	178, 229, 730
Bsp13I	TCCGGA	1 cut(s)	937
Bsp143I	GATC	8 cut(s)	30, 593, 765, 783, 1156, 1350, 1508, 1590
Bsp1720I	GCTNAGC	1 cut(s)	1298
BspACI	CCGC	4 cut(s)	145, 995, 998, 1039
BspANI	GGCC	3 cut(s)	178, 229, 730
BspCNI	CTCAG	9 cut(s)	315, 385, 610, 639, 1065, 1164, 1290, 1380, 1545
BspEI	TCCGGA	1 cut(s)	937
BspLI	GGNNCC	5 cut(s)	26, 179, 320, 321, 329
BspMAI	CTGCAG	6 cut(s)	351, 885, 1026, 1254, 1311, 1608
BspMI	ACCTGC	1 cut(s)	87
BspOI	GCTAGC	1 cut(s)	1306
BspPI	GGATC	2 cut(s)	1164, 1345
BsrDI	GCAATG	2 cut(s)	238, 1051
BsrI	ACTGG	5 cut(s)	359, 440, 474, 483, 491
BssECI	CCNNGG	5 cut(s)	57, 322, 323, 458, 662
BssMI	GATC	8 cut(s)	30, 593, 765, 783, 1156, 1350, 1508, 1590
BssNI	GRCGYC	1 cut(s)	1280
BssSI	CACGAG	1 cut(s)	291
Bst2BI	CACGAG	1 cut(s)	291
Bst2UI	CCWGG	5 cut(s)	58, 324, 551, 664, 1154
Bst4CI	ACNGT	7 cut(s)	341, 898, 1189, 1335, 1428, 1476, 1536
BstACI	GRCGYC	1 cut(s)	1280
BstAPI	GCANNNNNTGC	2 cut(s)	1021, 1048
BstC8I	GCNNGC	7 cut(s)	93, 227, 452, 556, 1058, 1265, 1304
BstF5I	GGATG	3 cut(s)	243, 302, 1182
BstKTI	GATC	8 cut(s)	33, 596, 768, 786, 1159, 1353, 1511, 1593
BstMAI	GTCTC	3 cut(s)	305, 814, 1417
BstMBI	GATC	8 cut(s)	30, 593, 765, 783, 1156, 1350, 1508, 1590
BstNI	CCWGG	5 cut(s)	58, 324, 551, 664, 1154
BstNSI	RCATGY	1 cut(s)	454
BstSCI	CCNGG	5 cut(s)	56, 322, 549, 662, 1152
BstSFI	CTRYAG	8 cut(s)	347, 881, 986, 1022, 1250, 1307, 1532, 1604
BstX2I	RGATCY	3 cut(s)	593, 783, 1156
BstYI	RGATCY	3 cut(s)	593, 783, 1156
Bsu36I	CCTNAGG	1 cut(s)	1388
BsuI	GTATCC	2 cut(s)	447, 768
BsuRI	GGCC	3 cut(s)	178, 229, 730
BtsCI	GGATG	3 cut(s)	243, 302, 1182
BtsI	GCAGTG	4 cut(s)	514, 701, 1511, 1577
BtsIMutI	CAGTG	9 cut(s)	401, 498, 514, 701, 1472, 1504, 1511, 1545, 1577
BveI	ACCTGC	1 cut(s)	87
Cac8I	GCNNGC	7 cut(s)	93, 227, 452, 556, 1058, 1265, 1304
CaiI	CAGNNNCTG	4 cut(s)	1021, 1159, 1315, 1426
Cfr13I	GGNCC	5 cut(s)	177, 228, 319, 616, 1384
CseI	GACGC	2 cut(s)	1288, 1601
Csp6I	GTAC	5 cut(s)	386, 485, 713, 1063, 1118
CspCI	CAANNNNNGTGG	2 cut(s)	515, 550
CviAII	CATG	4 cut(s)	126, 451, 732, 874
CviQI	GTAC	5 cut(s)	386, 485, 713, 1063, 1118
DpnI	GATC	8 cut(s)	32, 595, 767, 785, 1158, 1352, 1510, 1592
DpnII	GATC	8 cut(s)	30, 593, 765, 783, 1156, 1350, 1508, 1590
Eco47I	GGWCC	3 cut(s)	319, 616, 1384
Eco57I	CTGAAG	1 cut(s)	1403
Eco81I	CCTNAGG	1 cut(s)	1388
EcoO109I	RGGNCCY	2 cut(s)	177, 319
EcoRII	CCWGG	5 cut(s)	56, 322, 549, 662, 1152
EcoT22I	ATGCAT	1 cut(s)	1137
FaeI	CATG	4 cut(s)	129, 454, 735, 877
FalI	AAGNNNNNCTT	4 cut(s)	770, 802, 809, 841
FaqI	GGGAC	3 cut(s)	107, 291, 305
FatI	CATG	4 cut(s)	125, 450, 731, 873
FbaI	TGATCA	3 cut(s)	30, 765, 1508
FokI	GGATG	3 cut(s)	230, 309, 1189
FspBI	CTAG	7 cut(s)	383, 578, 674, 845, 1214, 1226, 1303
GsaI	CCCAGC	1 cut(s)	1586
GsuI	CTGGAG	1 cut(s)	1136
HaeIII	GGCC	3 cut(s)	178, 229, 730
HapII	CCGG	1 cut(s)	938
HgaI	GACGC	2 cut(s)	1288, 1601
Hin1I	GRCGYC	1 cut(s)	1280
Hin1II	CATG	4 cut(s)	129, 454, 735, 877
HindIII	AAGCTT	1 cut(s)	863
HpaII	CCGG	1 cut(s)	938
HphI	GGTGA	5 cut(s)	68, 134, 251, 539, 1360
Hpy166II	GTNNAC	1 cut(s)	43
Hpy188I	TCNGA	7 cut(s)	600, 620, 642, 765, 951, 1422, 1491
Hpy188III	TCNNGA	6 cut(s)	28, 578, 774, 901, 938, 1387
Hpy8I	GTNNAC	1 cut(s)	43
HpyAV	CCTTC	2 cut(s)	569, 1223
HpyCH4III	ACNGT	7 cut(s)	341, 898, 1189, 1335, 1428, 1476, 1536
Hsp92I	GRCGYC	1 cut(s)	1280
Hsp92II	CATG	4 cut(s)	129, 454, 735, 877
KflI	GGGWCCC	1 cut(s)	319
Kpn2I	TCCGGA	1 cut(s)	937
Ksp22I	TGATCA	3 cut(s)	30, 765, 1508
Kzo9I	GATC	8 cut(s)	30, 593, 765, 783, 1156, 1350, 1508, 1590
LmnI	GCTCC	3 cut(s)	152, 795, 1155
LweI	GCATC	5 cut(s)	252, 553, 942, 1255, 1637
MaeI	CTAG	7 cut(s)	383, 578, 674, 845, 1214, 1226, 1303
MaeIII	GTNAC	5 cut(s)	465, 669, 699, 892, 1548
MalI	GATC	8 cut(s)	32, 595, 767, 785, 1158, 1352, 1510, 1592
MboI	GATC	8 cut(s)	30, 593, 765, 783, 1156, 1350, 1508, 1590
MboII	GAAGA	3 cut(s)	1409, 1495, 1510
MflI	RGATCY	3 cut(s)	593, 783, 1156
MluCI	AATT	5 cut(s)	134, 285, 742, 964, 1464
MlyI	GAGTC	7 cut(s)	129, 399, 400, 517, 658, 816, 921
MmeI	TCCRAC	3 cut(s)	258, 899, 1458
Mph1103I	ATGCAT	1 cut(s)	1137
MroI	TCCGGA	1 cut(s)	937
MseI	TTAA	1 cut(s)	1430
MspA1I	CMGCKG	5 cut(s)	352, 886, 1000, 1021, 1027
MspI	CCGG	1 cut(s)	938
MspR9I	CCNGG	5 cut(s)	58, 324, 551, 664, 1154
Mva1269I	GAATGC	2 cut(s)	155, 1137
MvaI	CCWGG	5 cut(s)	58, 324, 551, 664, 1154
NdeII	GATC	8 cut(s)	30, 593, 765, 783, 1156, 1350, 1508, 1590
NheI	GCTAGC	1 cut(s)	1302
NlaIII	CATG	4 cut(s)	129, 454, 735, 877
NlaIV	GGNNCC	5 cut(s)	26, 179, 320, 321, 329
NmeAIII	GCCGAG	1 cut(s)	224
NmuCI	GTSAC	2 cut(s)	699, 892
NsiI	ATGCAT	1 cut(s)	1137
NspI	RCATGY	1 cut(s)	454
PaeI	GCATGC	1 cut(s)	454
PaqCI	CACCTGC	1 cut(s)	87
PasI	CCCWGGG	1 cut(s)	323
PctI	GAATGC	2 cut(s)	155, 1137
PfeI	GAWTC	3 cut(s)	601, 1089, 1486
PfoI	TCCNGGA	1 cut(s)	1152
PleI	GAGTC	7 cut(s)	128, 399, 399, 517, 657, 816, 920
PpsI	GAGTC	7 cut(s)	128, 399, 399, 517, 657, 816, 920
PpuMI	RGGWCCY	1 cut(s)	319
PsiI	TTATAA	1 cut(s)	1561
Psp5II	RGGWCCY	1 cut(s)	319
Psp6I	CCWGG	5 cut(s)	56, 322, 549, 662, 1152
PspFI	CCCAGC	1 cut(s)	1582
PspGI	CCWGG	5 cut(s)	56, 322, 549, 662, 1152
PspN4I	GGNNCC	5 cut(s)	26, 179, 320, 321, 329
PspPI	GGNCC	5 cut(s)	177, 228, 319, 616, 1384
PspPPI	RGGWCCY	1 cut(s)	319
PsrI	GAACNNNNNNTAC	2 cut(s)	33, 65
PstI	CTGCAG	6 cut(s)	351, 885, 1026, 1254, 1311, 1608
PstNI	CAGNNNCTG	4 cut(s)	1021, 1159, 1315, 1426
PsuI	RGATCY	3 cut(s)	593, 783, 1156
PvuII	CAGCTG	4 cut(s)	352, 886, 1021, 1027
RsaI	GTAC	5 cut(s)	387, 486, 714, 1064, 1119
RsaNI	GTAC	5 cut(s)	386, 485, 713, 1063, 1118
SaqAI	TTAA	1 cut(s)	1430
Sau3AI	GATC	8 cut(s)	30, 593, 765, 783, 1156, 1350, 1508, 1590
Sau96I	GGNCC	5 cut(s)	177, 228, 319, 616, 1384
ScaI	AGTACT	2 cut(s)	1064, 1119
SchI	GAGTC	7 cut(s)	129, 399, 400, 517, 658, 816, 921
ScrFI	CCNGG	5 cut(s)	58, 324, 551, 664, 1154
SfaNI	GCATC	5 cut(s)	252, 553, 942, 1255, 1637
SfcI	CTRYAG	8 cut(s)	347, 881, 986, 1022, 1250, 1307, 1532, 1604
SinI	GGWCC	3 cut(s)	319, 616, 1384
SmlI	CTYRAG	2 cut(s)	772, 1643
SmoI	CTYRAG	2 cut(s)	772, 1643
SpeI	ACTAGT	1 cut(s)	673
SphI	GCATGC	1 cut(s)	454
Sse9I	AATT	5 cut(s)	134, 285, 742, 964, 1464
SsiI	CCGC	4 cut(s)	145, 995, 998, 1039
SspMI	CTAG	7 cut(s)	383, 578, 674, 845, 1214, 1226, 1303
StyD4I	CCNGG	5 cut(s)	56, 322, 549, 662, 1152
TaaI	ACNGT	7 cut(s)	341, 898, 1189, 1335, 1428, 1476, 1536
TaqI	TCGA	1 cut(s)	87
TasI	AATT	5 cut(s)	134, 285, 742, 964, 1464
TatI	WGTACW	3 cut(s)	385, 1062, 1117
TauI	GCSGC	3 cut(s)	997, 1000, 1042
TfiI	GAWTC	3 cut(s)	601, 1089, 1486
Tru1I	TTAA	1 cut(s)	1430
Tru9I	TTAA	1 cut(s)	1430
TscAI	CASTG	9 cut(s)	401, 498, 521, 708, 1479, 1511, 1518, 1545, 1584
TseFI	GTSAC	2 cut(s)	699, 892
Tsp45I	GTSAC	2 cut(s)	699, 892
TspDTI	ATGAA	4 cut(s)	41, 128, 416, 551
TspGWI	ACGGA	1 cut(s)	1460
TspRI	CASTG	9 cut(s)	401, 498, 521, 708, 1479, 1511, 1518, 1545, 1584
VpaK11BI	GGWCC	3 cut(s)	319, 616, 1384
XapI	RAATTY	2 cut(s)	285, 1464
XbaI	TCTAGA	1 cut(s)	577
XceI	RCATGY	1 cut(s)	454
XspI	CTAG	7 cut(s)	383, 578, 674, 845, 1214, 1226, 1303
ZrmI	AGTACT	2 cut(s)	1064, 1119
Zsp2I	ATGCAT	1 cut(s)	1137

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.