Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0028924.1

Orthogroup ID

OG0002198

Physical Location & Seq

Genomic Coordinates Reverse (-)

4798 .. 8889

Gene Structure 4092 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0028924.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1371 bp

atggaaattgacaaggttaaggatccagccacagttaaattacattcgcaagttgagatggggtcgatggagctgaagtcaatattgggatatgatgatcagggcttagtcgctgctcctgagaaaaaatcttcggatgaggctcccctcaaagttctatattctagtggttcaggaagctttaatcgcaaggtcatgaggaatactgtggttcatagcatcagaactgtagttttctcttcaagactaaacttactcatgccttttggcccattagcaatcttagttcagactttgactggccatcatggctgggtcttccttctaagcttgttgggcatcatacctttggctgagcggttaggatatgctacagagcagctggcttgctacacaggacctacagttggaggccttctaaatgccacttttggaaatgccacagaattgataatctcaatatatgctttgagaaatggcatgattcgcgttgttcaacagtctttactgggctcaatcttgtcaaacatgttgctagtacttggatgtgcattctttgctggtggactcgtgttttctaagaggccacaagtgttcaacaagccaactgctgccgtgaattcgggattgctgttgatggcagtcatgggtcttctccttccagctttacttcacactactcacacagagttgcactttgggaagtctgcactagccctttcaaggtttactagctgcattatgcttgtggcatatgcttcctatctgttttttcagctgaagagccagcggagtctatatgtcccagttgatgagcagggggaggagattcacagtgatgccagtgatgatgatgacgaggttcctgaaatctctaagtgggaatccataatttggctcactattctaactgcatggatttcaatcctttcagaatatttagttaacgcgatagagggtgcgtctgttgcactgaatattcctgtagcatttatcagtgttattttgctcccaattgttgggaacgcagcagagcatgcaggtgctgttatgtttgccatgaaagacaagcttgatataactttgggagtggccataggttcatcaacccagatatctatgtttggaattcccttttgtgtgatggttgggtggataatgggggtccctatggacttgaatttccaactgtttgagacagccacgcttttcataaccgttctggtggtagctttcatgctacaggagggaacttccaactactttaaaggaataatgctcattctttgttacattattgttgctgcaagtttctttgtacatatagaccctactgcaatacaggacaagcccccggaaacaaaagagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000325 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005774 GO:0009705 GO:0016020 GO:0031090 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044437 GO:0044444 GO:0044446 GO:0044464 GO:0098588 GO:0098805

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Na_Ca_ex

Protein Analysis

456

Amino Acids

49.57

Weight (kDa)

5.5

Isoelectric Point (pI)

34.82

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002198)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G55730 AT1G55730 AT3G13320
fragaria_vesca	FvH4_3g41890 FvH4_3g41890 FvH4_3g41890 FvH4_3g41890 FvH4_3g41890 FvH4_3g41890 FvH4_3g41890 FvH4_3g41890 FvH4_6g40200 FvH4_6g40200 FvH4_6g40200
malus_domestica	MD03G1040300.v1.1 MD09G1134300.v1.1 MD11G1041700.v1.1 MD17G1123100.v1.1
prunus_persica	Prupe.3G192400_v2.0.a1 Prupe.6G032600_v2.0.a1 Prupe.6G032600_v2.0.a1 Prupe.6G032600_v2.0.a1
pyrus_communis	pycom03g03100 pycom11g03540
rosa_chinensis	RchiOBHm_Chr2g0155221 RchiOBHm_Chr5g0075081
rosa_laevigata	RLG00000020827 RLG00000036528
rosa_multiflora	Rmu_sc0006984.1_g000024 Rmu_sc0012066.1_g000002 Rmu_sc0028924.1_g000002
rosa_roxburghii	Rroxscaffold_1G00006540 Rroxscaffold_2G00093860
rosa_rugosa	Rorug02G0446100 Rorug02G0446100 Rorug05G0436000 Rorug05G0436100
rosa_samantha	Rh2AG512500 Rh2CG497500 Rh5AG493500 Rh5CG538700
rosa_wichuraiana	Rw2G042100 Rw5G045760

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	1031
Acc36I	ACCTGC	1 cut(s)	1031
AccB7I	CCANNNNNTGG	2 cut(s)	894, 1019
AccBSI	CCGCTC	1 cut(s)	358
AccII	CGCG	2 cut(s)	489, 950
AciI	CCGC	2 cut(s)	358, 790
AclWI	GGATC	2 cut(s)	17, 30
AcoI	YGGCCR	2 cut(s)	301, 1092
AcsI	RAATTY	3 cut(s)	619, 1128, 1180
AcuI	CTGAAG	2 cut(s)	95, 800
AfaI	GTAC	2 cut(s)	540, 1320
AfiI	CCNNNNNNNGG	4 cut(s)	407, 723, 894, 1019
AflIII	ACRYGT	1 cut(s)	528
AgsI	TTSAA	6 cut(s)	243, 497, 598, 723, 924, 1180
AjuI	GAANNNNNNNTTGG	2 cut(s)	68, 100
AluBI	AGCT	9 cut(s)	73, 180, 330, 382, 665, 735, 778, 1072, 1232
AluI	AGCT	9 cut(s)	73, 180, 330, 382, 665, 735, 778, 1072, 1232
Alw26I	GTCTC	1 cut(s)	1190
AlwI	GGATC	2 cut(s)	17, 30
AlwNI	CAGNNNCTG	1 cut(s)	1046
AoxI	GGCC	5 cut(s)	268, 301, 412, 584, 1092
ApeKI	GCWGC	6 cut(s)	113, 379, 611, 735, 1028, 1304
ApoI	RAATTY	3 cut(s)	619, 1128, 1180
AspS9I	GGNCC	3 cut(s)	269, 398, 1165
AsuC2I	CCSGG	1 cut(s)	1355
AvaII	GGWCC	2 cut(s)	398, 1165
BalI	TGGCCA	2 cut(s)	303, 1094
BamHI	GGATCC	1 cut(s)	22
BanII	GRGCYC	1 cut(s)	515
BauI	CACGAG	1 cut(s)	569
BbsI	GAAGAC	2 cut(s)	310, 644
BbvI	GCAGC	6 cut(s)	100, 391, 598, 722, 1040, 1291
BccI	CCATC	5 cut(s)	52, 61, 312, 631, 1138
BceAI	ACGGC	1 cut(s)	599
BclI	TGATCA	1 cut(s)	97
BcnI	CCSGG	1 cut(s)	1355
BcoDI	GTCTC	1 cut(s)	1190
BfaI	CTAG	4 cut(s)	165, 536, 713, 732
BfmI	CTRYAG	5 cut(s)	228, 372, 402, 984, 1241
BfuAI	ACCTGC	1 cut(s)	1031
BglI	GCCNNNNNGGC	1 cut(s)	309
BisI	GCNGC	6 cut(s)	114, 380, 612, 736, 1029, 1305
BlpI	GCTNAGC	1 cut(s)	354
BlsI	GCNGC	6 cut(s)	115, 381, 613, 737, 1030, 1306
BmcAI	AGTACT	1 cut(s)	540
Bme1390I	CCNGG	1 cut(s)	1355
Bme18I	GGWCC	2 cut(s)	398, 1165
BmgT120I	GGNCC	3 cut(s)	269, 398, 1165
BmiI	GGNNCC	5 cut(s)	24, 144, 864, 1166, 1167
BmrFI	CCNGG	1 cut(s)	1355
BmrI	ACTGGG	2 cut(s)	518, 800
BmsI	GCATC	3 cut(s)	228, 348, 829
BmuI	ACTGGG	2 cut(s)	518, 800
BpiI	GAAGAC	2 cut(s)	310, 644
Bpu1102I	GCTNAGC	1 cut(s)	354
BpuMI	CCSGG	1 cut(s)	1355
BsaBI	GATNNNNATC	1 cut(s)	923
BsaJI	CCNNGG	1 cut(s)	1353
BsaXI	ACNNNNNCTCC	2 cut(s)	62, 92
Bsc4I	CCNNNNNNNGG	4 cut(s)	407, 723, 894, 1019
Bse1I	ACTGG	4 cut(s)	304, 513, 806, 843
Bse8I	GATNNNNATC	1 cut(s)	923
BseDI	CCNNGG	1 cut(s)	1353
BseGI	GGATG	2 cut(s)	142, 551
BseJI	GATNNNNATC	1 cut(s)	923
BseLI	CCNNNNNNNGG	4 cut(s)	407, 723, 894, 1019
BseMII	CTCAG	2 cut(s)	111, 345
BseNI	ACTGG	4 cut(s)	304, 513, 806, 843
BseRI	GAGGAG	1 cut(s)	839
BseXI	GCAGC	6 cut(s)	100, 391, 598, 722, 1040, 1291
BseYI	CCCAGC	1 cut(s)	312
BsgI	GTGCAG	1 cut(s)	693
Bsh1236I	CGCG	2 cut(s)	489, 950
BshFI	GGCC	5 cut(s)	270, 303, 414, 586, 1094
BsiSI	CCGG	1 cut(s)	1355
BslFI	GGGAC	2 cut(s)	788, 1151
BslI	CCNNNNNNNGG	4 cut(s)	407, 723, 894, 1019
BsmAI	GTCTC	1 cut(s)	1190
BsmFI	GGGAC	2 cut(s)	788, 1151
BsmI	GAATGC	1 cut(s)	551
BsnI	GGCC	5 cut(s)	270, 303, 414, 586, 1094
Bsp1286I	GDGCHC	1 cut(s)	515
Bsp1407I	TGTACA	1 cut(s)	1318
Bsp143I	GATC	2 cut(s)	22, 97
Bsp1720I	GCTNAGC	1 cut(s)	354
BspACI	CCGC	2 cut(s)	358, 790
BspANI	GGCC	5 cut(s)	270, 303, 414, 586, 1094
BspCNI	CTCAG	2 cut(s)	112, 346
BspFNI	CGCG	2 cut(s)	489, 950
BspHI	TCATGA	1 cut(s)	195
BspLI	GGNNCC	5 cut(s)	24, 144, 864, 1166, 1167
BspMI	ACCTGC	1 cut(s)	1031
BspPI	GGATC	2 cut(s)	17, 30
BspQI	GCTCTTC	1 cut(s)	776
BsrBI	CCGCTC	1 cut(s)	358
BsrGI	TGTACA	1 cut(s)	1318
BsrI	ACTGG	4 cut(s)	304, 513, 806, 843
BssECI	CCNNGG	1 cut(s)	1353
BssMI	GATC	2 cut(s)	22, 97
BssSI	CACGAG	1 cut(s)	569
Bst2BI	CACGAG	1 cut(s)	569
Bst4CI	ACNGT	8 cut(s)	34, 208, 229, 406, 501, 836, 1191, 1219
Bst6I	CTCTTC	2 cut(s)	244, 776
BstAPI	GCANNNNNTGC	2 cut(s)	557, 1037
BstAUI	TGTACA	1 cut(s)	1318
BstC8I	GCNNGC	4 cut(s)	384, 388, 788, 1038
BstDEI	CTNAG	7 cut(s)	106, 120, 283, 326, 354, 579, 876
BstF5I	GGATG	2 cut(s)	142, 551
BstFNI	CGCG	2 cut(s)	489, 950
BstKTI	GATC	2 cut(s)	25, 100
BstMAI	GTCTC	1 cut(s)	1190
BstMBI	GATC	2 cut(s)	22, 97
BstMWI	GCNNNNNNNGC	7 cut(s)	186, 309, 336, 486, 557, 968, 1037
BstNSI	RCATGY	2 cut(s)	532, 1040
BstSCI	CCNGG	1 cut(s)	1353
BstSFI	CTRYAG	5 cut(s)	228, 372, 402, 984, 1241
BstUI	CGCG	2 cut(s)	489, 950
BstV1I	GCAGC	6 cut(s)	100, 391, 598, 722, 1040, 1291
BstV2I	GAAGAC	2 cut(s)	310, 644
BstX2I	RGATCY	1 cut(s)	22
BstYI	RGATCY	1 cut(s)	22
BsuRI	GGCC	5 cut(s)	270, 303, 414, 586, 1094
BtsCI	GGATG	2 cut(s)	142, 551
BtsIMutI	CAGTG	4 cut(s)	841, 850, 971, 1003
BveI	ACCTGC	1 cut(s)	1031
Cac8I	GCNNGC	4 cut(s)	384, 388, 788, 1038
CaiI	CAGNNNCTG	1 cut(s)	1046
CciI	TCATGA	1 cut(s)	195
Cfr13I	GGNCC	3 cut(s)	269, 398, 1165
CseI	GACGC	1 cut(s)	951
Csp6I	GTAC	2 cut(s)	539, 1319
CviQI	GTAC	2 cut(s)	539, 1319
DdeI	CTNAG	7 cut(s)	106, 120, 283, 326, 354, 579, 876
DpnI	GATC	2 cut(s)	24, 99
DpnII	GATC	2 cut(s)	22, 97
DraI	TTTAAA	1 cut(s)	1267
EaeI	YGGCCR	2 cut(s)	301, 1092
Eam1104I	CTCTTC	2 cut(s)	244, 776
EarI	CTCTTC	2 cut(s)	244, 776
Eco147I	AGGCCT	1 cut(s)	414
Eco24I	GRGCYC	1 cut(s)	515
Eco32I	GATATC	1 cut(s)	1116
Eco47I	GGWCC	2 cut(s)	398, 1165
Eco57I	CTGAAG	2 cut(s)	95, 800
EcoO109I	RGGNCCY	2 cut(s)	398, 1165
EcoRI	GAATTC	2 cut(s)	619, 1128
EcoRV	GATATC	1 cut(s)	1116
EcoT38I	GRGCYC	1 cut(s)	515
FalI	AAGNNNNNCTT	2 cut(s)	1056, 1088
FaqI	GGGAC	2 cut(s)	788, 1151
FauNDI	CATATG	1 cut(s)	754
FbaI	TGATCA	1 cut(s)	97
Fnu4HI	GCNGC	6 cut(s)	114, 380, 612, 736, 1029, 1305
FokI	GGATG	2 cut(s)	149, 558
FriOI	GRGCYC	1 cut(s)	515
Fsp4HI	GCNGC	6 cut(s)	114, 380, 612, 736, 1029, 1305
FspBI	CTAG	4 cut(s)	165, 536, 713, 732
GluI	GCNGC	6 cut(s)	114, 380, 612, 736, 1029, 1305
GsaI	CCCAGC	1 cut(s)	316
HaeIII	GGCC	5 cut(s)	270, 303, 414, 586, 1094
HapII	CCGG	1 cut(s)	1355
HgaI	GACGC	1 cut(s)	951
HincII	GTYRAC	1 cut(s)	946
HindII	GTYRAC	1 cut(s)	946
HindIII	AAGCTT	3 cut(s)	178, 328, 1070
HinfI	GANTC	5 cut(s)	484, 567, 793, 829, 884
HpaI	GTTAAC	1 cut(s)	946
HpaII	CCGG	1 cut(s)	1355
Hpy166II	GTNNAC	3 cut(s)	566, 729, 946
Hpy188I	TCNGA	4 cut(s)	136, 224, 291, 934
Hpy188III	TCNNGA	6 cut(s)	119, 174, 196, 243, 624, 866
Hpy8I	GTNNAC	3 cut(s)	566, 729, 946
HpyAV	CCTTC	3 cut(s)	332, 425, 668
HpyCH4III	ACNGT	8 cut(s)	34, 208, 229, 406, 501, 836, 1191, 1219
HpyCH4V	TGCA	9 cut(s)	551, 694, 710, 738, 914, 971, 1040, 1307, 1337
HpyF10VI	GCNNNNNNNGC	7 cut(s)	186, 309, 336, 486, 557, 968, 1037
HpyF3I	CTNAG	7 cut(s)	106, 120, 283, 326, 354, 579, 876
KflI	GGGWCCC	1 cut(s)	1165
Ksp22I	TGATCA	1 cut(s)	97
KspAI	GTTAAC	1 cut(s)	946
Kzo9I	GATC	2 cut(s)	22, 97
LguI	GCTCTTC	1 cut(s)	776
LmnI	GCTCC	4 cut(s)	70, 121, 148, 1014
Lsp1109I	GCAGC	6 cut(s)	100, 391, 598, 722, 1040, 1291
LweI	GCATC	3 cut(s)	228, 348, 829
MaeI	CTAG	4 cut(s)	165, 536, 713, 732
MaeIII	GTNAC	1 cut(s)	1289
MalI	GATC	2 cut(s)	24, 99
MbiI	CCGCTC	1 cut(s)	358
MboI	GATC	2 cut(s)	22, 97
MboII	GAAGA	5 cut(s)	123, 231, 310, 644, 793
MfeI	CAATTG	1 cut(s)	1014
MflI	RGATCY	1 cut(s)	22
MhlI	GDGCHC	1 cut(s)	515
MlsI	TGGCCA	2 cut(s)	303, 1094
MluCI	AATT	8 cut(s)	6, 38, 446, 619, 891, 1014, 1128, 1180
MluNI	TGGCCA	2 cut(s)	303, 1094
MlyI	GAGTC	2 cut(s)	561, 802
MmeI	TCCRAC	3 cut(s)	388, 1210, 1281
MnlI	CCTC	9 cut(s)	133, 158, 192, 404, 576, 817, 853, 949, 1240
Mox20I	TGGCCA	2 cut(s)	303, 1094
MscI	TGGCCA	2 cut(s)	303, 1094
MseI	TTAA	5 cut(s)	18, 36, 183, 945, 1266
MslI	CAYNNNNRTG	2 cut(s)	837, 1041
Msp20I	TGGCCA	2 cut(s)	303, 1094
MspA1I	CMGCKG	3 cut(s)	382, 778, 790
MspI	CCGG	1 cut(s)	1355
MspR9I	CCNGG	1 cut(s)	1355
MunI	CAATTG	1 cut(s)	1014
Mva1269I	GAATGC	1 cut(s)	551
MvnI	CGCG	2 cut(s)	489, 950
MwoI	GCNNNNNNNGC	7 cut(s)	186, 309, 336, 486, 557, 968, 1037
NciI	CCSGG	1 cut(s)	1355
NdeI	CATATG	1 cut(s)	754
NdeII	GATC	2 cut(s)	22, 97
NlaIV	GGNNCC	5 cut(s)	24, 144, 864, 1166, 1167
NspI	RCATGY	2 cut(s)	532, 1040
PaeI	GCATGC	1 cut(s)	1040
PagI	TCATGA	1 cut(s)	195
PaqCI	CACCTGC	1 cut(s)	1031
PceI	AGGCCT	1 cut(s)	414
PciI	ACATGT	1 cut(s)	528
PciSI	GCTCTTC	1 cut(s)	776
PctI	GAATGC	1 cut(s)	551
PfeI	GAWTC	3 cut(s)	484, 829, 884
PflMI	CCANNNNNTGG	2 cut(s)	894, 1019
PkrI	GCNGC	6 cut(s)	115, 381, 613, 737, 1030, 1306
PleI	GAGTC	2 cut(s)	561, 801
PpsI	GAGTC	2 cut(s)	561, 801
PpuMI	RGGWCCY	2 cut(s)	398, 1165
PscI	ACATGT	1 cut(s)	528
Psp5II	RGGWCCY	2 cut(s)	398, 1165
PspFI	CCCAGC	1 cut(s)	312
PspN4I	GGNNCC	5 cut(s)	24, 144, 864, 1166, 1167
PspPI	GGNCC	3 cut(s)	269, 398, 1165
PspPPI	RGGWCCY	2 cut(s)	398, 1165
PstNI	CAGNNNCTG	1 cut(s)	1046
PsuI	RGATCY	1 cut(s)	22
PvuII	CAGCTG	2 cut(s)	382, 778
RsaI	GTAC	2 cut(s)	540, 1320
RsaNI	GTAC	2 cut(s)	539, 1319
RseI	CAYNNNNRTG	2 cut(s)	837, 1041
SapI	GCTCTTC	1 cut(s)	776
SaqAI	TTAA	5 cut(s)	18, 36, 183, 945, 1266
SatI	GCNGC	6 cut(s)	114, 380, 612, 736, 1029, 1305
Sau3AI	GATC	2 cut(s)	22, 97
Sau96I	GGNCC	3 cut(s)	269, 398, 1165
ScaI	AGTACT	1 cut(s)	540
SchI	GAGTC	2 cut(s)	561, 802
ScrFI	CCNGG	1 cut(s)	1355
SduI	GDGCHC	1 cut(s)	515
SfaNI	GCATC	3 cut(s)	228, 348, 829
SfcI	CTRYAG	5 cut(s)	228, 372, 402, 984, 1241
SinI	GGWCC	2 cut(s)	398, 1165
SmiMI	CAYNNNNRTG	2 cut(s)	837, 1041
SphI	GCATGC	1 cut(s)	1040
Sse9I	AATT	8 cut(s)	6, 38, 446, 619, 891, 1014, 1128, 1180
SseBI	AGGCCT	1 cut(s)	414
SsiI	CCGC	2 cut(s)	358, 790
SspI	AATATT	3 cut(s)	84, 938, 979
SspMI	CTAG	4 cut(s)	165, 536, 713, 732
StuI	AGGCCT	1 cut(s)	414
StyD4I	CCNGG	1 cut(s)	1353
TaaI	ACNGT	8 cut(s)	34, 208, 229, 406, 501, 836, 1191, 1219
TaqI	TCGA	1 cut(s)	65
TasI	AATT	8 cut(s)	6, 38, 446, 619, 891, 1014, 1128, 1180
TatI	WGTACW	2 cut(s)	538, 1318
TfiI	GAWTC	3 cut(s)	484, 829, 884
Tru1I	TTAA	5 cut(s)	18, 36, 183, 945, 1266
Tru9I	TTAA	5 cut(s)	18, 36, 183, 945, 1266
TscAI	CASTG	4 cut(s)	841, 850, 978, 1003
TseI	GCWGC	6 cut(s)	113, 379, 611, 735, 1028, 1304
TspDTI	ATGAA	5 cut(s)	203, 1076, 1092, 1201, 1225
TspRI	CASTG	4 cut(s)	841, 850, 978, 1003
Van91I	CCANNNNNTGG	2 cut(s)	894, 1019
VpaK11BI	GGWCC	2 cut(s)	398, 1165
XapI	RAATTY	3 cut(s)	619, 1128, 1180
XceI	RCATGY	2 cut(s)	532, 1040
XspI	CTAG	4 cut(s)	165, 536, 713, 732
ZrmI	AGTACT	1 cut(s)	540

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.