Rmu_sc0037517.1_g000001

F-box kelch-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0037517.1
OG0011533
Physical Location & Seq
Forward (+)
179 .. 472
294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0037517.1_g000001.1.cds

Sequence Viewer

Length: 294 bp
atggccggcgagccggattcagctccacaaacaaacacagtcagtcctgagttcgatgatgacagcattgctgagatactgtcaaggctgccggccaaatctctacttcgatttcgctgcgtacgcaagtcatggcgtgctttgatctccaatccctcttttgttaagcaacacctgagcaaagtcaacactaaccaccgcttcaacctcctcgtcggaacaaggccttcccaagcttctgtagtgaaggtagatgatgatggtgacgttgcagtcacacaagagctcaagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FBA_1 FBA_3

Protein Analysis

97

Amino Acids

10.75

Weight (kDa)

7.93

Isoelectric Point (pI)

37.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 272
AciI CCGC 1 cut(s) 199
AcoI YGGCCR 2 cut(s) 3, 93
AfaI GTAC 1 cut(s) 123
AgsI TTSAA 1 cut(s) 205
AluBI AGCT 3 cut(s) 23, 236, 286
AluI AGCT 3 cut(s) 23, 236, 286
Alw21I GWGCWC 1 cut(s) 288
AoxI GGCC 3 cut(s) 3, 93, 224
ApeKI GCWGC 2 cut(s) 88, 117
AsuHPI GGTGA 1 cut(s) 275
BanII GRGCYC 1 cut(s) 288
Bbv12I GWGCWC 1 cut(s) 288
BbvI GCAGC 2 cut(s) 75, 104
BccI CCATC 1 cut(s) 254
BcgI CGANNNNNNTGC 2 cut(s) 99, 133
BfmI CTRYAG 1 cut(s) 240
BisI GCNGC 2 cut(s) 89, 118
BlsI GCNGC 2 cut(s) 90, 119
Bpu10I CCTNAGC 1 cut(s) 176
BpuEI CTTGAG 1 cut(s) 272
Bse118I RCCGGY 2 cut(s) 5, 91
Bse3DI GCAATG 1 cut(s) 66
BseMI GCAATG 1 cut(s) 66
BseMII CTCAG 3 cut(s) 39, 63, 167
BseRI GAGGAG 1 cut(s) 200
BseXI GCAGC 2 cut(s) 75, 104
BshFI GGCC 3 cut(s) 5, 95, 226
BsiHKAI GWGCWC 1 cut(s) 288
BsiSI CCGG 3 cut(s) 6, 14, 92
BsiWI CGTACG 1 cut(s) 121
BsnI GGCC 3 cut(s) 5, 95, 226
Bsp1286I GDGCHC 1 cut(s) 288
Bsp143I GATC 1 cut(s) 144
BspACI CCGC 1 cut(s) 199
BspANI GGCC 3 cut(s) 5, 95, 226
BspCNI CTCAG 3 cut(s) 40, 64, 168
BsrDI GCAATG 1 cut(s) 66
BsrFI RCCGGY 2 cut(s) 5, 91
BssAI RCCGGY 2 cut(s) 5, 91
BssMI GATC 1 cut(s) 144
Bst4CI ACNGT 2 cut(s) 40, 81
BstC8I GCNNGC 4 cut(s) 7, 11, 93, 138
BstDEI CTNAG 3 cut(s) 48, 72, 176
BstKTI GATC 1 cut(s) 147
BstMBI GATC 1 cut(s) 144
BstMWI GCNNNNNNNGC 1 cut(s) 123
BstSFI CTRYAG 1 cut(s) 240
BstV1I GCAGC 2 cut(s) 75, 104
BsuRI GGCC 3 cut(s) 5, 95, 226
Cac8I GCNNGC 4 cut(s) 7, 11, 93, 138
Cfr10I RCCGGY 2 cut(s) 5, 91
Csp6I GTAC 1 cut(s) 122
CviAII CATG 1 cut(s) 132
CviJI RGCY 8 cut(s) 5, 13, 23, 88, 95, 226, 236, 286
CviKI_1 RGCY 8 cut(s) 5, 13, 23, 88, 95, 226, 236, 286
CviQI GTAC 1 cut(s) 122
DdeI CTNAG 3 cut(s) 48, 72, 176
DpnI GATC 1 cut(s) 146
DpnII GATC 1 cut(s) 144
DrdI GACNNNNNNGTC 1 cut(s) 272
DseDI GACNNNNNNGTC 1 cut(s) 272
EaeI YGGCCR 2 cut(s) 3, 93
Ecl136II GAGCTC 1 cut(s) 286
Eco147I AGGCCT 1 cut(s) 226
Eco24I GRGCYC 1 cut(s) 288
Eco53kI GAGCTC 1 cut(s) 286
EcoICRI GAGCTC 1 cut(s) 286
EcoT38I GRGCYC 1 cut(s) 288
FaeI CATG 1 cut(s) 135
FaiI YATR 1 cut(s) 133
FatI CATG 1 cut(s) 131
Fnu4HI GCNGC 2 cut(s) 89, 118
FriOI GRGCYC 1 cut(s) 288
Fsp4HI GCNGC 2 cut(s) 89, 118
GluI GCNGC 2 cut(s) 89, 118
HaeIII GGCC 3 cut(s) 5, 95, 226
HapII CCGG 3 cut(s) 6, 14, 92
Hin1II CATG 1 cut(s) 135
HincII GTYRAC 1 cut(s) 187
HindII GTYRAC 1 cut(s) 187
HindIII AAGCTT 1 cut(s) 234
HinfI GANTC 1 cut(s) 17
HpaII CCGG 3 cut(s) 6, 14, 92
HphI GGTGA 1 cut(s) 275
Hpy166II GTNNAC 1 cut(s) 187
Hpy188I TCNGA 1 cut(s) 218
Hpy188III TCNNGA 1 cut(s) 47
Hpy8I GTNNAC 1 cut(s) 187
Hpy99I CGWCG 1 cut(s) 218
HpyAV CCTTC 2 cut(s) 237, 241
HpyCH4III ACNGT 2 cut(s) 40, 81
HpyCH4IV ACGT 1 cut(s) 267
HpyCH4V TGCA 1 cut(s) 272
HpyF10VI GCNNNNNNNGC 1 cut(s) 123
HpyF3I CTNAG 3 cut(s) 48, 72, 176
HpySE526I ACGT 1 cut(s) 267
Hsp92II CATG 1 cut(s) 135
KroI GCCGGC 2 cut(s) 5, 91
KroNI GCCGGC 2 cut(s) 7, 93
Kzo9I GATC 1 cut(s) 144
LmnI GCTCC 1 cut(s) 28
LpnPI CCDG 5 cut(s) 19, 27, 60, 105, 188
Lsp1109I GCAGC 2 cut(s) 75, 104
MaeII ACGT 1 cut(s) 267
MaeIII GTNAC 2 cut(s) 263, 274
MalI GATC 1 cut(s) 146
MboI GATC 1 cut(s) 144
MhlI GDGCHC 1 cut(s) 288
MmeI TCCRAC 1 cut(s) 196
MnlI CCTC 3 cut(s) 166, 218, 221
MroNI GCCGGC 2 cut(s) 5, 91
MseI TTAA 1 cut(s) 165
MspI CCGG 3 cut(s) 6, 14, 92
MwoI GCNNNNNNNGC 1 cut(s) 123
NaeI GCCGGC 2 cut(s) 7, 93
NdeII GATC 1 cut(s) 144
NgoMIV GCCGGC 2 cut(s) 5, 91
NlaIII CATG 1 cut(s) 135
NmuCI GTSAC 2 cut(s) 263, 274
PceI AGGCCT 1 cut(s) 226
PdiI GCCGGC 2 cut(s) 7, 93
PfeI GAWTC 1 cut(s) 17
Pfl23II CGTACG 1 cut(s) 121
PkrI GCNGC 2 cut(s) 90, 119
Psp124BI GAGCTC 1 cut(s) 288
PspLI CGTACG 1 cut(s) 121
RsaI GTAC 1 cut(s) 123
RsaNI GTAC 1 cut(s) 122
SacI GAGCTC 1 cut(s) 288
SaqAI TTAA 1 cut(s) 165
SatI GCNGC 2 cut(s) 89, 118
Sau3AI GATC 1 cut(s) 144
SduI GDGCHC 1 cut(s) 288
SetI ASST 7 cut(s) 25, 177, 210, 238, 252, 270, 288
SfcI CTRYAG 1 cut(s) 240
SmlI CTYRAG 1 cut(s) 287
SmoI CTYRAG 1 cut(s) 287
SseBI AGGCCT 1 cut(s) 226
SsiI CCGC 1 cut(s) 199
SstI GAGCTC 1 cut(s) 288
StuI AGGCCT 1 cut(s) 226
TaaI ACNGT 2 cut(s) 40, 81
TaiI ACGT 1 cut(s) 270
TaqI TCGA 2 cut(s) 54, 109
TfiI GAWTC 1 cut(s) 17
Tru1I TTAA 1 cut(s) 165
Tru9I TTAA 1 cut(s) 165
TseFI GTSAC 2 cut(s) 263, 274
TseI GCWGC 2 cut(s) 88, 117
Tsp45I GTSAC 2 cut(s) 263, 274
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.