Rh5BG047500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
3806506 .. 3808946
2441 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG047500.1

Sequence Viewer

Length: 198 bp
ATGGTAAGCAGAGTGGAGAACAAGGGTGCAAGAATGGAGATTTCGTCCTTCAAACTACCAGCTCCTTCAGGTTGGAGTAAGAAAGGTCGCAGGAGAGAGAGAGGCAGATGGAGCCAGCAGCCTAAATTAAATCCACCACCTTGCTCAAATATTCCTTCACAGCCTGCACCTACCAGCTCAAACGATCCATCATCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.19

Weight (kDa)

11.33

Isoelectric Point (pI)

95.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 179
AcuI CTGAAG 1 cut(s) 51
AgsI TTSAA 1 cut(s) 52
AluBI AGCT 2 cut(s) 62, 177
AluI AGCT 2 cut(s) 62, 177
AlwI GGATC 1 cut(s) 179
ApeKI GCWGC 1 cut(s) 118
BbvI GCAGC 1 cut(s) 130
BccI CCATC 2 cut(s) 102, 196
BisI GCNGC 1 cut(s) 119
BlsI GCNGC 1 cut(s) 120
BmiI GGNNCC 1 cut(s) 113
BsaXI ACNNNNNCTCC 2 cut(s) 29, 59
BseXI GCAGC 1 cut(s) 130
BsgI GTGCAG 1 cut(s) 150
Bsp143I GATC 1 cut(s) 184
BspLI GGNNCC 1 cut(s) 113
BspPI GGATC 1 cut(s) 179
BssMI GATC 1 cut(s) 184
BstC8I GCNNGC 2 cut(s) 116, 165
BstKTI GATC 1 cut(s) 187
BstMBI GATC 1 cut(s) 184
BstMWI GCNNNNNNNGC 1 cut(s) 111
BstV1I GCAGC 1 cut(s) 130
Cac8I GCNNGC 2 cut(s) 116, 165
CviJI RGCY 5 cut(s) 62, 114, 121, 163, 177
CviKI_1 RGCY 5 cut(s) 62, 114, 121, 163, 177
DpnI GATC 1 cut(s) 186
DpnII GATC 1 cut(s) 184
Eco57I CTGAAG 1 cut(s) 51
Fnu4HI GCNGC 1 cut(s) 119
Fsp4HI GCNGC 1 cut(s) 119
GluI GCNGC 1 cut(s) 119
HpyAV CCTTC 3 cut(s) 58, 75, 165
HpyCH4V TGCA 2 cut(s) 29, 167
HpyF10VI GCNNNNNNNGC 1 cut(s) 111
Kzo9I GATC 1 cut(s) 184
LmnI GCTCC 2 cut(s) 67, 111
LpnPI CCDG 6 cut(s) 54, 72, 76, 128, 177, 187
Lsp1109I GCAGC 1 cut(s) 130
MalI GATC 1 cut(s) 186
MboI GATC 1 cut(s) 184
MluCI AATT 1 cut(s) 125
MmeI TCCRAC 1 cut(s) 53
MnlI CCTC 1 cut(s) 95
MseI TTAA 2 cut(s) 128, 196
MwoI GCNNNNNNNGC 1 cut(s) 111
NdeII GATC 1 cut(s) 184
NlaIV GGNNCC 1 cut(s) 113
PkrI GCNGC 1 cut(s) 120
PspN4I GGNNCC 1 cut(s) 113
SaqAI TTAA 2 cut(s) 128, 196
SatI GCNGC 1 cut(s) 119
Sau3AI GATC 1 cut(s) 184
SetI ASST 6 cut(s) 64, 73, 88, 142, 172, 179
SgeI CNNG 9 cut(s) 34, 42, 71, 81, 103, 127, 153, 176, 186
Sse9I AATT 1 cut(s) 125
SspI AATATT 1 cut(s) 151
TasI AATT 1 cut(s) 125
Tru1I TTAA 2 cut(s) 128, 196
Tru9I TTAA 2 cut(s) 128, 196
TseI GCWGC 1 cut(s) 118
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.