Rroxscaffold_1G00069780

F-box kelch-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0011533
Physical Location & Seq
Forward (+)
90657289 .. 90657909
621 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00069780.1

Sequence Viewer

Length: 537 bp
ATGGCCGACTCCATACCAATTCGGGGACAGCAACAACAAATTAACACTGTCAGTCGTGACTTCGACGAGGCCATCATCGTTGACATACTGTCCAGGTTACCGGCCAAATCTCTACTAAGGTTTTGCTCTGTATGCAAATTATGGCCTACTTTAATCCCTGATCCCTATTTTGTGAAGAAGCACCTTAGCCGCGATAGAACCAACTGCCTCAAGCTCCTTGTCGGAACACGGGGTTCCCAAGCCGCCATTATATCGAAAGAAGATAATGGCAATGTTGCAATACAGAGCTTGATTTCCCGTACTAGAGAATTCAAGCTGTTACCGGAAGCACCTACTGTTGATGATGATGTCCCTTTGGGAATGTCCGACCCTAATGAGTTGTATTGGTTTGGATTCGGTTATGATTCCACCATTGAAGATTACAAGGTAATACGAGCCACAGAAACCACAATGCATGTCTTTACCCTCAAGACAGGTTCATGGAAGATGATAAAAAATATGAGGGATTCTCTCATGCCGAAAGGAGCCCAGGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FBA_1 FBA_3

Protein Analysis

178

Amino Acids

20.1

Weight (kDa)

8.42

Isoelectric Point (pI)

37.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box PF00646 24 - 59 8.8e-07 F-box domain
F-box-like PF12937 25 - 57 3e-06 F-box-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 192
AciI CCGC 2 cut(s) 190, 243
AclWI GGATC 1 cut(s) 155
AcoI YGGCCR 2 cut(s) 3, 102
AcsI RAATTY 1 cut(s) 308
AfaI GTAC 1 cut(s) 301
AfiI CCNNNNNNNGG 1 cut(s) 23
AgsI TTSAA 2 cut(s) 313, 416
AhdI GACNNNNNGTC 1 cut(s) 88
AjnI CCWGG 2 cut(s) 92, 528
AluBI AGCT 3 cut(s) 214, 288, 316
AluI AGCT 3 cut(s) 214, 288, 316
AlwI GGATC 1 cut(s) 155
AoxI GGCC 4 cut(s) 3, 69, 102, 143
ApoI RAATTY 1 cut(s) 308
BanII GRGCYC 1 cut(s) 529
BccI CCATC 1 cut(s) 80
BciT130I CCWGG 2 cut(s) 94, 530
BfaI CTAG 1 cut(s) 303
BisI GCNGC 2 cut(s) 190, 243
BlsI GCNGC 2 cut(s) 191, 244
Bme1390I CCNGG 2 cut(s) 94, 530
BmeRI GACNNNNNGTC 1 cut(s) 88
BmiI GGNNCC 2 cut(s) 235, 526
BmrFI CCNGG 2 cut(s) 94, 530
BplI GAGNNNNNCTC 2 cut(s) 493, 525
Bpu10I CCTNAGC 1 cut(s) 185
BpuEI CTTGAG 2 cut(s) 194, 452
BsaJI CCNNGG 2 cut(s) 528, 529
BsaWI WCCGGW 1 cut(s) 322
Bsc4I CCNNNNNNNGG 1 cut(s) 23
Bse118I RCCGGY 1 cut(s) 100
Bse3DI GCAATG 1 cut(s) 277
BseBI CCWGG 2 cut(s) 94, 530
BseDI CCNNGG 2 cut(s) 528, 529
BseLI CCNNNNNNNGG 1 cut(s) 23
BseMI GCAATG 1 cut(s) 277
Bsh1236I CGCG 1 cut(s) 192
BshFI GGCC 4 cut(s) 5, 71, 104, 145
BsiSI CCGG 2 cut(s) 101, 323
BslFI GGGAC 2 cut(s) 39, 335
BslI CCNNNNNNNGG 1 cut(s) 23
BsmFI GGGAC 2 cut(s) 39, 335
BsnI GGCC 4 cut(s) 5, 71, 104, 145
Bsp1286I GDGCHC 1 cut(s) 529
Bsp143I GATC 1 cut(s) 160
BspACI CCGC 2 cut(s) 190, 243
BspANI GGCC 4 cut(s) 5, 71, 104, 145
BspFNI CGCG 1 cut(s) 192
BspLI GGNNCC 2 cut(s) 235, 526
BspPI GGATC 1 cut(s) 155
BsrDI GCAATG 1 cut(s) 277
BsrFI RCCGGY 1 cut(s) 100
BssAI RCCGGY 1 cut(s) 100
BssECI CCNNGG 2 cut(s) 528, 529
BssMI GATC 1 cut(s) 160
Bst2UI CCWGG 2 cut(s) 94, 530
Bst4CI ACNGT 3 cut(s) 49, 90, 337
BstDEI CTNAG 2 cut(s) 116, 185
BstEII GGTNACC 1 cut(s) 96
BstFNI CGCG 1 cut(s) 192
BstKTI GATC 1 cut(s) 163
BstMBI GATC 1 cut(s) 160
BstMWI GCNNNNNNNGC 1 cut(s) 132
BstNI CCWGG 2 cut(s) 94, 530
BstNSI RCATGY 1 cut(s) 458
BstPI GGTNACC 1 cut(s) 96
BstSCI CCNGG 2 cut(s) 92, 528
BstUI CGCG 1 cut(s) 192
BsuRI GGCC 4 cut(s) 5, 71, 104, 145
BtsIMutI CAGTG 1 cut(s) 45
Cfr10I RCCGGY 1 cut(s) 100
Csp6I GTAC 1 cut(s) 300
CviAII CATG 3 cut(s) 455, 480, 514
CviQI GTAC 1 cut(s) 300
DdeI CTNAG 2 cut(s) 116, 185
DpnI GATC 1 cut(s) 162
DpnII GATC 1 cut(s) 160
DriI GACNNNNNGTC 1 cut(s) 88
EaeI YGGCCR 2 cut(s) 3, 102
Eam1105I GACNNNNNGTC 1 cut(s) 88
Eco24I GRGCYC 1 cut(s) 529
Eco91I GGTNACC 1 cut(s) 96
EcoO65I GGTNACC 1 cut(s) 96
EcoRI GAATTC 1 cut(s) 308
EcoRII CCWGG 2 cut(s) 92, 528
EcoT22I ATGCAT 1 cut(s) 456
EcoT38I GRGCYC 1 cut(s) 529
FaeI CATG 3 cut(s) 458, 483, 517
FaqI GGGAC 2 cut(s) 39, 335
FatI CATG 3 cut(s) 454, 479, 513
Fnu4HI GCNGC 2 cut(s) 190, 243
FriOI GRGCYC 1 cut(s) 529
Fsp4HI GCNGC 2 cut(s) 190, 243
FspBI CTAG 1 cut(s) 303
GluI GCNGC 2 cut(s) 190, 243
HaeIII GGCC 4 cut(s) 5, 71, 104, 145
HapII CCGG 2 cut(s) 101, 323
Hin1II CATG 3 cut(s) 458, 483, 517
HincII GTYRAC 1 cut(s) 82
HindII GTYRAC 1 cut(s) 82
HinfI GANTC 4 cut(s) 8, 393, 404, 506
HpaII CCGG 2 cut(s) 101, 323
Hpy166II GTNNAC 1 cut(s) 82
Hpy188I TCNGA 2 cut(s) 224, 367
Hpy188III TCNNGA 2 cut(s) 56, 469
Hpy8I GTNNAC 1 cut(s) 82
Hpy99I CGWCG 1 cut(s) 68
HpyCH4III ACNGT 3 cut(s) 49, 90, 337
HpyCH4V TGCA 3 cut(s) 135, 278, 454
HpyF10VI GCNNNNNNNGC 1 cut(s) 132
HpyF3I CTNAG 2 cut(s) 116, 185
Hsp92II CATG 3 cut(s) 458, 483, 517
Kzo9I GATC 1 cut(s) 160
LmnI GCTCC 2 cut(s) 219, 524
LpnPI CCDG 7 cut(s) 79, 106, 114, 171, 336, 459, 515
MaeI CTAG 1 cut(s) 303
MaeIII GTNAC 3 cut(s) 56, 96, 318
MalI GATC 1 cut(s) 162
MboI GATC 1 cut(s) 160
MboII GAAGA 4 cut(s) 187, 272, 428, 496
MhlI GDGCHC 1 cut(s) 529
MluCI AATT 4 cut(s) 18, 39, 137, 308
MlyI GAGTC 1 cut(s) 2
MmeI TCCRAC 2 cut(s) 202, 390
MnlI CCTC 4 cut(s) 61, 218, 476, 495
Mph1103I ATGCAT 1 cut(s) 456
MseI TTAA 2 cut(s) 42, 152
MspI CCGG 2 cut(s) 101, 323
MspR9I CCNGG 2 cut(s) 94, 530
MvaI CCWGG 2 cut(s) 94, 530
MvnI CGCG 1 cut(s) 192
MwoI GCNNNNNNNGC 1 cut(s) 132
NdeII GATC 1 cut(s) 160
NlaIII CATG 3 cut(s) 458, 483, 517
NlaIV GGNNCC 2 cut(s) 235, 526
NmuCI GTSAC 1 cut(s) 56
NsiI ATGCAT 1 cut(s) 456
NspI RCATGY 1 cut(s) 458
PasI CCCWGGG 1 cut(s) 529
PfeI GAWTC 3 cut(s) 393, 404, 506
PkrI GCNGC 2 cut(s) 191, 244
PleI GAGTC 1 cut(s) 2
PpsI GAGTC 1 cut(s) 2
Psp6I CCWGG 2 cut(s) 92, 528
PspEI GGTNACC 1 cut(s) 96
PspGI CCWGG 2 cut(s) 92, 528
PspN4I GGNNCC 2 cut(s) 235, 526
RsaI GTAC 1 cut(s) 301
RsaNI GTAC 1 cut(s) 300
SaqAI TTAA 2 cut(s) 42, 152
SatI GCNGC 2 cut(s) 190, 243
Sau3AI GATC 1 cut(s) 160
SchI GAGTC 1 cut(s) 2
ScrFI CCNGG 2 cut(s) 94, 530
SduI GDGCHC 1 cut(s) 529
SetI ASST 9 cut(s) 98, 122, 186, 216, 290, 318, 334, 429, 478
SmlI CTYRAG 2 cut(s) 209, 467
SmoI CTYRAG 2 cut(s) 209, 467
Sse9I AATT 4 cut(s) 18, 39, 137, 308
SsiI CCGC 2 cut(s) 190, 243
SspMI CTAG 1 cut(s) 303
StyD4I CCNGG 2 cut(s) 92, 528
TaaI ACNGT 3 cut(s) 49, 90, 337
TaqI TCGA 2 cut(s) 63, 254
TasI AATT 4 cut(s) 18, 39, 137, 308
TauI GCSGC 2 cut(s) 192, 245
TfiI GAWTC 3 cut(s) 393, 404, 506
Tru1I TTAA 2 cut(s) 42, 152
Tru9I TTAA 2 cut(s) 42, 152
TscAI CASTG 1 cut(s) 52
TseFI GTSAC 1 cut(s) 56
Tsp45I GTSAC 1 cut(s) 56
TspDTI ATGAA 1 cut(s) 468
TspRI CASTG 1 cut(s) 52
XapI RAATTY 1 cut(s) 308
XceI RCATGY 1 cut(s) 458
XspI CTAG 1 cut(s) 303
Zsp2I ATGCAT 1 cut(s) 456
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.