Rroxscaffold_1G00069740

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
90626506 .. 90630769
4264 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00069740.1

Sequence Viewer

Length: 189 bp
ATGGCAAGCAGAGTGGAGAACAAGGGTGCAAGAATGGAGATTTTGTCCTTCAAACTAGCAGCTCCGATCCTTCAGGTTGGAGTAAGAAAGTGTGTCTTGATTTATGGTCTAGATGGACATGTTAGTGATGATTTGAAATTGAAAAGCTTTGAGAAGAAATCACAATTTAAGCAAGTCAAAAAACCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.98

Weight (kDa)

9.93

Isoelectric Point (pI)

21.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 61
AcuI CTGAAG 1 cut(s) 56
AflIII ACRYGT 1 cut(s) 118
AgsI TTSAA 3 cut(s) 52, 136, 142
AluBI AGCT 2 cut(s) 62, 147
AluI AGCT 2 cut(s) 62, 147
AlwI GGATC 1 cut(s) 61
ApeKI GCWGC 1 cut(s) 59
BbvI GCAGC 1 cut(s) 71
BccI CCATC 1 cut(s) 107
BfaI CTAG 2 cut(s) 56, 110
BisI GCNGC 1 cut(s) 60
BlsI GCNGC 1 cut(s) 61
BsaXI ACNNNNNCTCC 2 cut(s) 29, 59
BseXI GCAGC 1 cut(s) 71
Bsp143I GATC 1 cut(s) 66
BspPI GGATC 1 cut(s) 61
BssMI GATC 1 cut(s) 66
BstC8I GCNNGC 1 cut(s) 7
BstKTI GATC 1 cut(s) 69
BstMBI GATC 1 cut(s) 66
BstNSI RCATGY 1 cut(s) 122
BstV1I GCAGC 1 cut(s) 71
Cac8I GCNNGC 1 cut(s) 7
CspCI CAANNNNNGTGG 1 cut(s) 29
CviAII CATG 2 cut(s) 119, 186
CviJI RGCY 2 cut(s) 62, 147
CviKI_1 RGCY 2 cut(s) 62, 147
DpnI GATC 1 cut(s) 68
DpnII GATC 1 cut(s) 66
Eco57I CTGAAG 1 cut(s) 56
FaeI CATG 2 cut(s) 122, 189
FaiI YATR 3 cut(s) 105, 120, 187
FalI AAGNNNNNCTT 2 cut(s) 80, 112
FatI CATG 2 cut(s) 118, 185
Fnu4HI GCNGC 1 cut(s) 60
Fsp4HI GCNGC 1 cut(s) 60
FspBI CTAG 2 cut(s) 56, 110
GluI GCNGC 1 cut(s) 60
Hin1II CATG 2 cut(s) 122, 189
HindIII AAGCTT 1 cut(s) 145
Hpy188I TCNGA 1 cut(s) 66
Hpy188III TCNNGA 2 cut(s) 97, 110
HpyAV CCTTC 2 cut(s) 58, 80
HpyCH4V TGCA 1 cut(s) 29
Hsp92II CATG 2 cut(s) 122, 189
Kzo9I GATC 1 cut(s) 66
LmnI GCTCC 1 cut(s) 67
LpnPI CCDG 1 cut(s) 59
Lsp1109I GCAGC 1 cut(s) 71
MaeI CTAG 2 cut(s) 56, 110
MalI GATC 1 cut(s) 68
MboI GATC 1 cut(s) 66
MboII GAAGA 1 cut(s) 166
MluCI AATT 2 cut(s) 137, 164
MmeI TCCRAC 1 cut(s) 58
MseI TTAA 1 cut(s) 168
MslI CAYNNNNRTG 1 cut(s) 123
NdeII GATC 1 cut(s) 66
NlaIII CATG 2 cut(s) 122, 189
NspI RCATGY 1 cut(s) 122
PciI ACATGT 1 cut(s) 118
PkrI GCNGC 1 cut(s) 61
PscI ACATGT 1 cut(s) 118
RseI CAYNNNNRTG 1 cut(s) 123
SaqAI TTAA 1 cut(s) 168
SatI GCNGC 1 cut(s) 60
Sau3AI GATC 1 cut(s) 66
SetI ASST 3 cut(s) 64, 78, 149
SgeI CNNG 9 cut(s) 18, 34, 42, 68, 86, 109, 122, 131, 185
SmiMI CAYNNNNRTG 1 cut(s) 123
Sse9I AATT 2 cut(s) 137, 164
SspMI CTAG 2 cut(s) 56, 110
TasI AATT 2 cut(s) 137, 164
Tru1I TTAA 1 cut(s) 168
Tru9I TTAA 1 cut(s) 168
TseI GCWGC 1 cut(s) 59
XbaI TCTAGA 1 cut(s) 109
XceI RCATGY 1 cut(s) 122
XspI CTAG 2 cut(s) 56, 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.