Rmu_sc0038613.1_g000001

Chitinase domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0038613.1
OG0010301
Physical Location & Seq
Forward (+)
1 .. 584
584 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0038613.1_g000001.1.cds

Sequence Viewer

Length: 348 bp
tttgactcccttttgcacttggattgcgatcttgagataaatctgttactttctgagtatctgacagaatttttggtatttcaaaagccaatatatgaagctaatgttgataaatttctgatggaagccaggtttgatgggaactccgaactggttgctgagttggtcactgtaaatgggttcaaagctgcttatgccataaaagacggtgcagaaggaccccgaggatgggtgagtagtggccttccttggataccaccatcaaaagcactgagcgttgattttggcagtttcgcggatactattagtggtgctgtcggagtaattctcttgactttcttacattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Glyco_hydro_18

Protein Analysis

115

Amino Acids

12.6

Weight (kDa)

4.37

Isoelectric Point (pI)

17.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 296
AciI CCGC 1 cut(s) 296
AcsI RAATTY 2 cut(s) 68, 113
AfiI CCNNNNNNNGG 2 cut(s) 228, 229
AgsI TTSAA 2 cut(s) 83, 184
AjnI CCWGG 1 cut(s) 128
AluBI AGCT 2 cut(s) 101, 188
AluI AGCT 2 cut(s) 101, 188
Ama87I CYCGRG 1 cut(s) 222
AoxI GGCC 1 cut(s) 241
ApeKI GCWGC 1 cut(s) 188
ApoI RAATTY 2 cut(s) 68, 113
ArsI GACNNNNNNTTYG 2 cut(s) 55, 87
AspS9I GGNCC 1 cut(s) 218
AsuHPI GGTGA 1 cut(s) 244
AvaI CYCGRG 1 cut(s) 222
AvaII GGWCC 1 cut(s) 218
BbvI GCAGC 1 cut(s) 175
BccI CCATC 4 cut(s) 115, 131, 222, 268
BcgI CGANNNNNNTGC 2 cut(s) 137, 171
BciT130I CCWGG 1 cut(s) 130
BciVI GTATCC 2 cut(s) 246, 292
BfuI GTATCC 2 cut(s) 246, 292
BisI GCNGC 1 cut(s) 189
BlsI GCNGC 1 cut(s) 190
Bme1390I CCNGG 1 cut(s) 130
Bme18I GGWCC 1 cut(s) 218
BmeT110I CYCGRG 1 cut(s) 222
BmgT120I GGNCC 1 cut(s) 218
BmiI GGNNCC 1 cut(s) 220
BmrFI CCNGG 1 cut(s) 130
BplI GAGNNNNNCTC 2 cut(s) 312, 344
BpuEI CTTGAG 1 cut(s) 53
BsaBI GATNNNNATC 1 cut(s) 27
BsaJI CCNNGG 2 cut(s) 223, 248
Bsc4I CCNNNNNNNGG 2 cut(s) 228, 229
Bse1I ACTGG 1 cut(s) 156
Bse8I GATNNNNATC 1 cut(s) 27
BseBI CCWGG 1 cut(s) 130
BseDI CCNNGG 2 cut(s) 223, 248
BseGI GGATG 1 cut(s) 233
BseJI GATNNNNATC 1 cut(s) 27
BseLI CCNNNNNNNGG 2 cut(s) 228, 229
BseMII CTCAG 3 cut(s) 45, 150, 263
BseNI ACTGG 1 cut(s) 156
BseXI GCAGC 1 cut(s) 175
BsgI GTGCAG 1 cut(s) 231
Bsh1236I CGCG 1 cut(s) 296
BshFI GGCC 1 cut(s) 243
BsiHKCI CYCGRG 1 cut(s) 222
BslI CCNNNNNNNGG 2 cut(s) 228, 229
BsnI GGCC 1 cut(s) 243
BsoBI CYCGRG 1 cut(s) 222
Bsp143I GATC 1 cut(s) 28
BspACI CCGC 1 cut(s) 296
BspANI GGCC 1 cut(s) 243
BspCNI CTCAG 3 cut(s) 46, 151, 264
BspFNI CGCG 1 cut(s) 296
BspLI GGNNCC 1 cut(s) 220
BsrI ACTGG 1 cut(s) 156
BssECI CCNNGG 2 cut(s) 223, 248
BssMI GATC 1 cut(s) 28
BssT1I CCWWGG 1 cut(s) 248
Bst2UI CCWGG 1 cut(s) 130
Bst4CI ACNGT 2 cut(s) 172, 209
BstDEI CTNAG 3 cut(s) 54, 159, 272
BstF5I GGATG 1 cut(s) 233
BstFNI CGCG 1 cut(s) 296
BstKTI GATC 1 cut(s) 31
BstMBI GATC 1 cut(s) 28
BstMWI GCNNNNNNNGC 1 cut(s) 194
BstNI CCWGG 1 cut(s) 130
BstSCI CCNGG 1 cut(s) 128
BstUI CGCG 1 cut(s) 296
BstV1I GCAGC 1 cut(s) 175
BsuI GTATCC 2 cut(s) 246, 292
BsuRI GGCC 1 cut(s) 243
BtsCI GGATG 1 cut(s) 233
BtsIMutI CAGTG 2 cut(s) 168, 269
Cfr13I GGNCC 1 cut(s) 218
CviJI RGCY 5 cut(s) 88, 101, 128, 188, 243
CviKI_1 RGCY 5 cut(s) 88, 101, 128, 188, 243
DdeI CTNAG 3 cut(s) 54, 159, 272
DpnI GATC 1 cut(s) 30
DpnII GATC 1 cut(s) 28
Eco130I CCWWGG 1 cut(s) 248
Eco47I GGWCC 1 cut(s) 218
Eco88I CYCGRG 1 cut(s) 222
EcoO109I RGGNCCY 1 cut(s) 218
EcoRII CCWGG 1 cut(s) 128
EcoT14I CCWWGG 1 cut(s) 248
ErhI CCWWGG 1 cut(s) 248
FaiI YATR 4 cut(s) 94, 96, 195, 200
Fnu4HI GCNGC 1 cut(s) 189
FokI GGATG 1 cut(s) 240
Fsp4HI GCNGC 1 cut(s) 189
GluI GCNGC 1 cut(s) 189
HaeIII GGCC 1 cut(s) 243
HinfI GANTC 1 cut(s) 5
HphI GGTGA 1 cut(s) 244
Hpy188I TCNGA 5 cut(s) 55, 63, 120, 148, 320
Hpy188III TCNNGA 2 cut(s) 32, 331
HpyAV CCTTC 2 cut(s) 209, 254
HpyCH4III ACNGT 2 cut(s) 172, 209
HpyCH4V TGCA 2 cut(s) 16, 212
HpyF10VI GCNNNNNNNGC 1 cut(s) 194
HpyF3I CTNAG 3 cut(s) 54, 159, 272
Kzo9I GATC 1 cut(s) 28
LpnPI CCDG 3 cut(s) 115, 137, 142
Lsp1109I GCAGC 1 cut(s) 175
MaeIII GTNAC 2 cut(s) 45, 166
MalI GATC 1 cut(s) 30
MboI GATC 1 cut(s) 28
MluCI AATT 3 cut(s) 68, 113, 324
MmeI TCCRAC 1 cut(s) 298
MnlI CCTC 1 cut(s) 218
MspR9I CCNGG 1 cut(s) 130
MvaI CCWGG 1 cut(s) 130
MvnI CGCG 1 cut(s) 296
MwoI GCNNNNNNNGC 1 cut(s) 194
NdeII GATC 1 cut(s) 28
NlaIV GGNNCC 1 cut(s) 220
NmuCI GTSAC 1 cut(s) 166
PkrI GCNGC 1 cut(s) 190
PpuMI RGGWCCY 1 cut(s) 218
Psp5II RGGWCCY 1 cut(s) 218
Psp6I CCWGG 1 cut(s) 128
PspGI CCWGG 1 cut(s) 128
PspN4I GGNNCC 1 cut(s) 220
PspPI GGNCC 1 cut(s) 218
PspPPI RGGWCCY 1 cut(s) 218
SatI GCNGC 1 cut(s) 189
Sau3AI GATC 1 cut(s) 28
Sau96I GGNCC 1 cut(s) 218
ScrFI CCNGG 1 cut(s) 130
SetI ASST 3 cut(s) 103, 134, 190
SinI GGWCC 1 cut(s) 218
SmlI CTYRAG 1 cut(s) 32
SmoI CTYRAG 1 cut(s) 32
Sse9I AATT 3 cut(s) 68, 113, 324
SsiI CCGC 1 cut(s) 296
StyD4I CCNGG 1 cut(s) 128
StyI CCWWGG 1 cut(s) 248
TaaI ACNGT 2 cut(s) 172, 209
TasI AATT 3 cut(s) 68, 113, 324
TscAI CASTG 2 cut(s) 175, 276
TseFI GTSAC 1 cut(s) 166
TseI GCWGC 1 cut(s) 188
Tsp45I GTSAC 1 cut(s) 166
TspDTI ATGAA 1 cut(s) 111
TspRI CASTG 2 cut(s) 175, 276
VpaK11BI GGWCC 1 cut(s) 218
XapI RAATTY 2 cut(s) 68, 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.