Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0039003.1

Orthogroup ID

OG0002451

Physical Location & Seq

Genomic Coordinates Reverse (-)

73 .. 2434

Gene Structure 2362 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0039003.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 714 bp

atggggtttcttggcaggtacacagcgacgacgatactggcattgctgcaggaagtggcacacttgttgcagtcggagaagatcgattgggataagttggtggccaatactacaactgggattacaaatgctagagagtttcagatgctttggcgacatttggcttatagggaacctttgcctgacaaattcgatgatggagctcggcctcaggatgtagatagtgattacgaatatgaagtggaagttgctcctcctgttagcggtgaagcttcaacagaggctgcagcatgtgtgaaggtccttatggcttctggtctaccaagtgattctagtcatctgaatggcacaacggtggaggctccattgacaataaatatacctaatggccagtcatctaaaacatatgaaccatctgcttcagcaaaaggcatgaacattacagttccagtttctattcagaaacagaccctccctgcaacgacaactactgcagcagcaaaagctgaaggagatgatgcaaatagatcaactagcaatatcatggctcctcggaagaagagaaagaagtggacagaggaggaggatttggaactggtctctgctgtgaacatatatggtgaaggaaattggactcaaatcgtaaaagcaaacttcaaaggggacagaactgctaatcagctatctcaggttttttcctgtcagcccaagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Myb_DNA-binding

Protein Analysis

237

Amino Acids

25.85

Weight (kDa)

5.2

Isoelectric Point (pI)

44.66

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002451)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G09710 AT1G09710 AT1G09710 AT1G09710 AT1G09710 AT1G58220 AT1G58220
fragaria_vesca	FvH4_4g17970 FvH4_5g34820 FvH4_5g34820 FvH4_5g34820 FvH4_5g34820 FvH4_5g34820 FvH4_5g34820
malus_domestica	MD08G1198900.v1.1 MD15G1385800.v1.1 MD15G1386000.v1.1
prunus_persica	Prupe.1G532600_v2.0.a1 Prupe.1G532600_v2.0.a1 Prupe.1G532600_v2.0.a1 Prupe.1G532600_v2.0.a1 Prupe.1G532700_v2.0.a1 Prupe.1G532700_v2.0.a1 Prupe.1G532700_v2.0.a1 Prupe.1G532700_v2.0.a1
pyrus_communis	pycom08g17100 pycom08g17280 pycom15g34620
rosa_chinensis	RchiOBHm_Chr7g0235501
rosa_laevigata	RLG00000001154
rosa_multiflora	Rmu_sc0002892.1_g000016 Rmu_sc0004498.1_g000008 Rmu_sc0039003.1_g000001
rosa_roxburghii	Rroxscaffold_3G00225950
rosa_rugosa	Rorug07G0291300 Rorug07G0291400
rosa_samantha	Rh7AG446400 Rh7BG418100 Rh7CG466300 Rh7DG434900
rosa_wichuraiana	Rw7G037060

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	6
AccI	GTMKAC	1 cut(s)	319
AciI	CCGC	1 cut(s)	264
AcoI	YGGCCR	2 cut(s)	102, 388
AcsI	RAATTY	1 cut(s)	188
AcuI	CTGAAG	2 cut(s)	405, 528
AfaI	GTAC	1 cut(s)	20
AfiI	CCNNNNNNNGG	1 cut(s)	263
AgsI	TTSAA	2 cut(s)	276, 658
AleI	CACNNNNGTG	1 cut(s)	353
AluBI	AGCT	4 cut(s)	203, 272, 506, 682
AluI	AGCT	4 cut(s)	203, 272, 506, 682
Alw21I	GWGCWC	1 cut(s)	205
Alw26I	GTCTC	1 cut(s)	604
AlwNI	CAGNNNCTG	1 cut(s)	284
AoxI	GGCC	3 cut(s)	102, 206, 388
ApeKI	GCWGC	5 cut(s)	46, 284, 287, 494, 497
ApoI	RAATTY	1 cut(s)	188
AspS9I	GGNCC	1 cut(s)	301
AsuHPI	GGTGA	2 cut(s)	278, 632
AvaII	GGWCC	1 cut(s)	301
AxyI	CCTNAGG	1 cut(s)	210
BalI	TGGCCA	2 cut(s)	104, 390
BanII	GRGCYC	1 cut(s)	205
Bbv12I	GWGCWC	1 cut(s)	205
BbvI	GCAGC	5 cut(s)	33, 271, 299, 506, 509
BccI	CCATC	2 cut(s)	191, 421
BcoDI	GTCTC	1 cut(s)	604
BfaI	CTAG	3 cut(s)	132, 333, 534
BfmI	CTRYAG	3 cut(s)	47, 285, 492
BfuAI	ACCTGC	1 cut(s)	6
BisI	GCNGC	5 cut(s)	47, 285, 288, 495, 498
BlsI	GCNGC	5 cut(s)	48, 286, 289, 496, 499
Bme18I	GGWCC	1 cut(s)	301
BmgT120I	GGNCC	1 cut(s)	301
BmiI	GGNNCC	3 cut(s)	174, 363, 549
BmrI	ACTGGG	1 cut(s)	126
BmsI	GCATC	2 cut(s)	135, 508
BmuI	ACTGGG	1 cut(s)	126
Bsa29I	ATCGAT	1 cut(s)	84
BsaI	GGTCTC	1 cut(s)	604
BsaJI	CCNNGG	1 cut(s)	551
BsaXI	ACNNNNNCTCC	2 cut(s)	456, 486
Bsc4I	CCNNNNNNNGG	1 cut(s)	263
Bse1I	ACTGG	5 cut(s)	42, 121, 391, 449, 600
Bse21I	CCTNAGG	1 cut(s)	210
Bse3DI	GCAATG	1 cut(s)	41
BseCI	ATCGAT	1 cut(s)	84
BseDI	CCNNGG	1 cut(s)	551
BseGI	GGATG	1 cut(s)	220
BseLI	CCNNNNNNNGG	1 cut(s)	263
BseMI	GCAATG	1 cut(s)	41
BseMII	CTCAG	2 cut(s)	224, 701
BseNI	ACTGG	5 cut(s)	42, 121, 391, 449, 600
BseRI	GAGGAG	4 cut(s)	243, 540, 593, 596
BseXI	GCAGC	5 cut(s)	33, 271, 299, 506, 509
BshFI	GGCC	3 cut(s)	104, 208, 390
BshVI	ATCGAT	1 cut(s)	84
BsiHKAI	GWGCWC	1 cut(s)	205
BslFI	GGGAC	1 cut(s)	677
BslI	CCNNNNNNNGG	1 cut(s)	263
BsmAI	GTCTC	1 cut(s)	604
BsmFI	GGGAC	1 cut(s)	677
BsnI	GGCC	3 cut(s)	104, 208, 390
Bso31I	GGTCTC	1 cut(s)	604
Bsp1286I	GDGCHC	1 cut(s)	205
Bsp143I	GATC	2 cut(s)	81, 527
BspACI	CCGC	1 cut(s)	264
BspANI	GGCC	3 cut(s)	104, 208, 390
BspCNI	CTCAG	2 cut(s)	223, 700
BspDI	ATCGAT	1 cut(s)	84
BspLI	GGNNCC	3 cut(s)	174, 363, 549
BspMAI	CTGCAG	3 cut(s)	51, 289, 496
BspMI	ACCTGC	1 cut(s)	6
BspTNI	GGTCTC	1 cut(s)	604
BsrDI	GCAATG	1 cut(s)	41
BsrI	ACTGG	5 cut(s)	42, 121, 391, 449, 600
BssECI	CCNNGG	1 cut(s)	551
BssMI	GATC	2 cut(s)	81, 527
Bst4CI	ACNGT	2 cut(s)	355, 445
Bst6I	CTCTTC	1 cut(s)	554
BstDEI	CTNAG	2 cut(s)	210, 687
BstF5I	GGATG	1 cut(s)	220
BstKTI	GATC	2 cut(s)	84, 530
BstMAI	GTCTC	1 cut(s)	604
BstMBI	GATC	2 cut(s)	81, 527
BstMWI	GCNNNNNNNGC	1 cut(s)	503
BstNSI	RCATGY	1 cut(s)	294
BstSFI	CTRYAG	3 cut(s)	47, 285, 492
BstV1I	GCAGC	5 cut(s)	33, 271, 299, 506, 509
Bsu15I	ATCGAT	1 cut(s)	84
Bsu36I	CCTNAGG	1 cut(s)	210
BsuRI	GGCC	3 cut(s)	104, 208, 390
BsuTUI	ATCGAT	1 cut(s)	84
BtsCI	GGATG	1 cut(s)	220
BveI	ACCTGC	1 cut(s)	6
CaiI	CAGNNNCTG	1 cut(s)	284
Cfr13I	GGNCC	1 cut(s)	301
ClaI	ATCGAT	1 cut(s)	84
Csp6I	GTAC	1 cut(s)	19
CviAII	CATG	3 cut(s)	291, 433, 544
CviQI	GTAC	1 cut(s)	19
DdeI	CTNAG	2 cut(s)	210, 687
DpnI	GATC	2 cut(s)	83, 529
DpnII	GATC	2 cut(s)	81, 527
EaeI	YGGCCR	2 cut(s)	102, 388
Eam1104I	CTCTTC	1 cut(s)	554
EarI	CTCTTC	1 cut(s)	554
Ecl136II	GAGCTC	1 cut(s)	203
Eco24I	GRGCYC	1 cut(s)	205
Eco31I	GGTCTC	1 cut(s)	604
Eco47I	GGWCC	1 cut(s)	301
Eco53kI	GAGCTC	1 cut(s)	203
Eco57I	CTGAAG	2 cut(s)	405, 528
Eco81I	CCTNAGG	1 cut(s)	210
EcoICRI	GAGCTC	1 cut(s)	203
EcoO109I	RGGNCCY	1 cut(s)	301
EcoT38I	GRGCYC	1 cut(s)	205
FaeI	CATG	3 cut(s)	294, 436, 547
FaqI	GGGAC	1 cut(s)	677
FatI	CATG	3 cut(s)	290, 432, 543
FauNDI	CATATG	1 cut(s)	406
FblI	GTMKAC	1 cut(s)	319
Fnu4HI	GCNGC	5 cut(s)	47, 285, 288, 495, 498
FokI	GGATG	1 cut(s)	227
FriOI	GRGCYC	1 cut(s)	205
Fsp4HI	GCNGC	5 cut(s)	47, 285, 288, 495, 498
FspBI	CTAG	3 cut(s)	132, 333, 534
GluI	GCNGC	5 cut(s)	47, 285, 288, 495, 498
HaeIII	GGCC	3 cut(s)	104, 208, 390
Hin1II	CATG	3 cut(s)	294, 436, 547
HindIII	AAGCTT	1 cut(s)	270
HinfI	GANTC	2 cut(s)	329, 634
HphI	GGTGA	2 cut(s)	278, 632
Hpy166II	GTNNAC	4 cut(s)	21, 320, 573, 610
Hpy188I	TCNGA	5 cut(s)	76, 144, 342, 462, 555
Hpy188III	TCNNGA	1 cut(s)	212
Hpy8I	GTNNAC	4 cut(s)	21, 320, 573, 610
Hpy99I	CGWCG	2 cut(s)	31, 34
HpyAV	CCTTC	3 cut(s)	292, 503, 617
HpyCH4III	ACNGT	2 cut(s)	355, 445
HpyCH4V	TGCA	6 cut(s)	49, 70, 287, 479, 494, 521
HpyF10VI	GCNNNNNNNGC	1 cut(s)	503
HpyF3I	CTNAG	2 cut(s)	210, 687
Hsp92II	CATG	3 cut(s)	294, 436, 547
Kzo9I	GATC	2 cut(s)	81, 527
LmnI	GCTCC	4 cut(s)	200, 256, 367, 553
Lsp1109I	GCAGC	5 cut(s)	33, 271, 299, 506, 509
LweI	GCATC	2 cut(s)	135, 508
MaeI	CTAG	3 cut(s)	132, 333, 534
MalI	GATC	2 cut(s)	83, 529
MboI	GATC	2 cut(s)	81, 527
MboII	GAAGA	3 cut(s)	91, 568, 571
MhlI	GDGCHC	1 cut(s)	205
MlsI	TGGCCA	2 cut(s)	104, 390
MluCI	AATT	2 cut(s)	188, 628
MluNI	TGGCCA	2 cut(s)	104, 390
MlyI	GAGTC	1 cut(s)	628
MmeI	TCCRAC	1 cut(s)	54
MnlI	CCTC	9 cut(s)	219, 264, 274, 352, 482, 561, 571, 574, 577
Mox20I	TGGCCA	2 cut(s)	104, 390
MscI	TGGCCA	2 cut(s)	104, 390
MslI	CAYNNNNRTG	2 cut(s)	342, 353
Msp20I	TGGCCA	2 cut(s)	104, 390
MwoI	GCNNNNNNNGC	1 cut(s)	503
NdeI	CATATG	1 cut(s)	406
NdeII	GATC	2 cut(s)	81, 527
NlaIII	CATG	3 cut(s)	294, 436, 547
NlaIV	GGNNCC	3 cut(s)	174, 363, 549
NmeAIII	GCCGAG	1 cut(s)	184
NspI	RCATGY	1 cut(s)	294
OliI	CACNNNNGTG	1 cut(s)	353
PfeI	GAWTC	1 cut(s)	329
PkrI	GCNGC	5 cut(s)	48, 286, 289, 496, 499
PleI	GAGTC	1 cut(s)	628
PpsI	GAGTC	1 cut(s)	628
PpuMI	RGGWCCY	1 cut(s)	301
Psp124BI	GAGCTC	1 cut(s)	205
Psp5II	RGGWCCY	1 cut(s)	301
PspN4I	GGNNCC	3 cut(s)	174, 363, 549
PspPI	GGNCC	1 cut(s)	301
PspPPI	RGGWCCY	1 cut(s)	301
PstI	CTGCAG	3 cut(s)	51, 289, 496
PstNI	CAGNNNCTG	1 cut(s)	284
RsaI	GTAC	1 cut(s)	20
RsaNI	GTAC	1 cut(s)	19
RseI	CAYNNNNRTG	2 cut(s)	342, 353
SacI	GAGCTC	1 cut(s)	205
SatI	GCNGC	5 cut(s)	47, 285, 288, 495, 498
Sau3AI	GATC	2 cut(s)	81, 527
Sau96I	GGNCC	1 cut(s)	301
SchI	GAGTC	1 cut(s)	628
SduI	GDGCHC	1 cut(s)	205
SetI	ASST	9 cut(s)	20, 178, 205, 274, 303, 385, 508, 684, 693
SfaNI	GCATC	2 cut(s)	135, 508
SfcI	CTRYAG	3 cut(s)	47, 285, 492
SinI	GGWCC	1 cut(s)	301
SmiMI	CAYNNNNRTG	2 cut(s)	342, 353
Sse9I	AATT	2 cut(s)	188, 628
SsiI	CCGC	1 cut(s)	264
SspMI	CTAG	3 cut(s)	132, 333, 534
SstI	GAGCTC	1 cut(s)	205
TaaI	ACNGT	2 cut(s)	355, 445
TaqI	TCGA	2 cut(s)	84, 192
TasI	AATT	2 cut(s)	188, 628
TfiI	GAWTC	1 cut(s)	329
TseI	GCWGC	5 cut(s)	46, 284, 287, 494, 497
TspDTI	ATGAA	3 cut(s)	252, 423, 449
VpaK11BI	GGWCC	1 cut(s)	301
XapI	RAATTY	1 cut(s)	188
XceI	RCATGY	1 cut(s)	294
XmiI	GTMKAC	1 cut(s)	319
XspI	CTAG	3 cut(s)	132, 333, 534

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.