Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000331.1

Orthogroup ID

OG0005176

Physical Location & Seq

Genomic Coordinates Forward (+)

36 .. 2118

Gene Structure 2083 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000331.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 978 bp

atgacgatgacgatggtggggaggaggttctacggcgaagatgtggtggaccaggccgaggctaagaatctcagggaggtcattagggaaggtgtggagctatctgcatcgacaaacttgggggactttttgccgttcatgcagtggatggatgttaccggtatggagaagaagatggtggggttgatgcggaggatggacaagttcttgcagggtttgctcgacgagcgtcggaaaatcatggcagtcgagtctgacggtatagatcaggttaagagtaagttgatgattgataacttattgtcactgcaagaagcagaacagaaatactacaccgacgatatcatcaagggcatcattatggtattgctggtggcggggactgacacggcatcaacgacaatggaatgggcaatggctctattgctaaaccatccagaaaggatgaacaaagtacgagctgagatagacgcaaaggttggagaagatcgtctattgaatgagcaagacttgccgaagttgaattacttgcaaaatgtgatcatggaggcacttcgcttgtacccacctgttccgctcctagtgcctcgtgaagcttccgaagattgtgtggttgggggattcgatgttccacgtggcacgatgctagtgattaatgcatgggccattcacagagaccccgagttttgggacgacccgacagaattcaagccggagaggtttgagggatggagcggtgagggtggcgagggatataaggtagtcccgttcggtgctgggagacgaggttgtcccggtgatgttctagccaaacggtttattgcattggcactaggaaccttggttcagtcgtttgagtgggggaggattagtgaagagaaagtggacatgagtgaagggttgggtcttacaatgccaaggatccatcccttggaggctttgtgcaaaccacgccctgttattgaggcttcaatgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00140 ko00905 ko00943 ko01100 ko01110 ko04913 ko04917 ko04927 ko04934 map00140 map00905 map00943 map01100 map01110 map04913 map04917 map04927 map04934

Pfam Domains

Protein Families

p450

Protein Analysis

325

Amino Acids

36.67

Weight (kDa)

4.92

Isoelectric Point (pI)

37.21

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005176)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g33580 FvH4_2g33630 FvH4_2g33640
malus_domestica	MD08G1091500.v1.1 MD15G1075400.v1.1 MD15G1075500.v1.1
prunus_persica	Prupe.1G428700_v2.0.a1
pyrus_communis	pycom08g07380 pycom15g07050 pycom15g07060 pycom15g07070
rosa_chinensis	RchiOBHm_Chr6g0251291 RchiOBHm_Chr6g0308911 RchiOBHm_Chr6g0308921 RchiOBHm_Chr6g0308931
rosa_laevigata	RLG00000010602 RLG00000010604 RLG00000010605
rosa_multiflora	Rmu_co8379885.1_g000001 Rmu_co8470555.1_g000001 Rmu_sc0004046.1_g000020 Rmu_sc0004046.1_g000023 Rmu_ssc0000331.1_g000001
rosa_roxburghii	Rroxscaffold_7G00159800
rosa_rugosa	Rorug06G0369200
rosa_samantha	Rh6AG480800 Rh6AG481000 Rh6DG481200 Rh6DG481300
rosa_wichuraiana	Rw6G041910

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	789
AccB7I	CCANNNNNTGG	1 cut(s)	931
AccBSI	CCGCTC	2 cut(s)	577, 735
AciI	CCGC	4 cut(s)	190, 377, 575, 735
AclWI	GGATC	2 cut(s)	916, 929
AcsI	RAATTY	1 cut(s)	704
AcvI	CACGTG	1 cut(s)	635
AfaI	GTAC	2 cut(s)	456, 563
AfiI	CCNNNNNNNGG	3 cut(s)	58, 687, 931
AgeI	ACCGGT	1 cut(s)	158
AgsI	TTSAA	4 cut(s)	499, 523, 709, 972
AjnI	CCWGG	1 cut(s)	51
AloI	GAACNNNNNNTCC	4 cut(s)	612, 644, 828, 860
AluBI	AGCT	3 cut(s)	100, 461, 596
AluI	AGCT	3 cut(s)	100, 461, 596
Alw26I	GTCTC	2 cut(s)	669, 775
AlwI	GGATC	2 cut(s)	916, 929
Ama87I	CYCGRG	1 cut(s)	680
AoxI	GGCC	2 cut(s)	54, 663
ApoI	RAATTY	1 cut(s)	704
AseI	ATTAAT	1 cut(s)	654
AsiGI	ACCGGT	1 cut(s)	158
AspS9I	GGNCC	2 cut(s)	49, 663
AsuC2I	CCSGG	1 cut(s)	795
AsuHPI	GGTGA	2 cut(s)	749, 809
AvaI	CYCGRG	1 cut(s)	680
AvaII	GGWCC	1 cut(s)	49
BamHI	GGATCC	1 cut(s)	921
BarI	GAAGNNNNNNTAC	2 cut(s)	509, 541
BauI	CACGAG	1 cut(s)	588
BbrPI	CACGTG	1 cut(s)	635
BccI	CCATC	7 cut(s)	7, 142, 169, 190, 441, 723, 933
BceAI	ACGGC	3 cut(s)	49, 118, 405
BciT130I	CCWGG	1 cut(s)	53
BclI	TGATCA	1 cut(s)	540
BcnI	CCSGG	1 cut(s)	795
BcoDI	GTCTC	2 cut(s)	669, 775
BfaI	CTAG	4 cut(s)	581, 647, 806, 833
Bme1390I	CCNGG	2 cut(s)	53, 795
Bme18I	GGWCC	1 cut(s)	49
BmeT110I	CYCGRG	1 cut(s)	680
BmgT120I	GGNCC	2 cut(s)	49, 663
BmiI	GGNNCC	2 cut(s)	838, 923
BmrFI	CCNGG	2 cut(s)	53, 795
BmsI	GCATC	5 cut(s)	116, 177, 363, 401, 633
BoxI	GACNNNNGTC	1 cut(s)	228
BpuMI	CCSGG	1 cut(s)	795
BsaAI	YACGTR	1 cut(s)	635
BsaI	GGTCTC	1 cut(s)	669
BsaJI	CCNNGG	4 cut(s)	57, 840, 917, 930
BsaWI	WCCGGW	1 cut(s)	158
BsaXI	ACNNNNNCTCC	6 cut(s)	772, 802, 856, 886, 926, 956
Bsc4I	CCNNNNNNNGG	3 cut(s)	58, 687, 931
Bse118I	RCCGGY	1 cut(s)	158
Bse3DI	GCAATG	1 cut(s)	420
BseBI	CCWGG	1 cut(s)	53
BseDI	CCNNGG	4 cut(s)	57, 840, 917, 930
BseGI	GGATG	7 cut(s)	153, 157, 201, 433, 450, 734, 925
BseLI	CCNNNNNNNGG	3 cut(s)	58, 687, 931
BseMI	GCAATG	1 cut(s)	420
BseMII	CTCAG	2 cut(s)	85, 453
BseRI	GAGGAG	1 cut(s)	37
BseYI	CCCAGC	1 cut(s)	776
BshFI	GGCC	2 cut(s)	56, 665
BshTI	ACCGGT	1 cut(s)	158
BsiHKCI	CYCGRG	1 cut(s)	680
BsiSI	CCGG	3 cut(s)	159, 713, 795
BslFI	GGGAC	5 cut(s)	137, 394, 704, 749, 777
BslI	CCNNNNNNNGG	3 cut(s)	58, 687, 931
BsmAI	GTCTC	2 cut(s)	669, 775
BsmBI	CGTCTC	1 cut(s)	775
BsmFI	GGGAC	5 cut(s)	137, 394, 704, 749, 777
BsnI	GGCC	2 cut(s)	56, 665
Bso31I	GGTCTC	1 cut(s)	669
BsoBI	CYCGRG	1 cut(s)	680
Bsp143I	GATC	4 cut(s)	265, 487, 540, 921
BspACI	CCGC	4 cut(s)	190, 377, 575, 735
BspANI	GGCC	2 cut(s)	56, 665
BspCNI	CTCAG	2 cut(s)	84, 454
BspLI	GGNNCC	2 cut(s)	838, 923
BspPI	GGATC	2 cut(s)	916, 929
BspTNI	GGTCTC	1 cut(s)	669
BsrBI	CCGCTC	2 cut(s)	577, 735
BsrDI	GCAATG	1 cut(s)	420
BsrFI	RCCGGY	1 cut(s)	158
BssAI	RCCGGY	1 cut(s)	158
BssECI	CCNNGG	4 cut(s)	57, 840, 917, 930
BssMI	GATC	4 cut(s)	265, 487, 540, 921
BssSI	CACGAG	1 cut(s)	588
BssT1I	CCWWGG	3 cut(s)	840, 917, 930
Bst2BI	CACGAG	1 cut(s)	588
Bst2UI	CCWGG	1 cut(s)	53
Bst4CI	ACNGT	2 cut(s)	260, 816
Bst6I	CTCTTC	1 cut(s)	870
BstAPI	GCANNNNNTGC	2 cut(s)	217, 511
BstBAI	YACGTR	1 cut(s)	635
BstDEI	CTNAG	3 cut(s)	63, 71, 462
BstF5I	GGATG	7 cut(s)	153, 157, 201, 433, 450, 734, 925
BstKTI	GATC	4 cut(s)	268, 490, 543, 924
BstMAI	GTCTC	2 cut(s)	669, 775
BstMBI	GATC	4 cut(s)	265, 487, 540, 921
BstMWI	GCNNNNNNNGC	6 cut(s)	139, 217, 226, 511, 583, 951
BstNI	CCWGG	1 cut(s)	53
BstPAI	GACNNNNGTC	1 cut(s)	228
BstSCI	CCNGG	2 cut(s)	51, 793
BstX2I	RGATCY	1 cut(s)	921
BstYI	RGATCY	1 cut(s)	921
BsuRI	GGCC	2 cut(s)	56, 665
BtsCI	GGATG	7 cut(s)	153, 157, 201, 433, 450, 734, 925
BtsI	GCAGTG	2 cut(s)	149, 305
BtsIMutI	CAGTG	2 cut(s)	149, 305
Cfr10I	RCCGGY	1 cut(s)	158
Cfr13I	GGNCC	2 cut(s)	49, 663
CseI	GACGC	2 cut(s)	218, 479
Csp6I	GTAC	2 cut(s)	455, 562
CspAI	ACCGGT	1 cut(s)	158
CviAII	CATG	5 cut(s)	139, 241, 544, 660, 889
CviQI	GTAC	2 cut(s)	455, 562
DdeI	CTNAG	3 cut(s)	63, 71, 462
DpnI	GATC	4 cut(s)	267, 489, 542, 923
DpnII	GATC	4 cut(s)	265, 487, 540, 921
DrdI	GACNNNNNNGTC	1 cut(s)	789
DseDI	GACNNNNNNGTC	1 cut(s)	789
Eam1104I	CTCTTC	1 cut(s)	870
EarI	CTCTTC	1 cut(s)	870
Eco130I	CCWWGG	3 cut(s)	840, 917, 930
Eco31I	GGTCTC	1 cut(s)	669
Eco32I	GATATC	1 cut(s)	343
Eco47I	GGWCC	1 cut(s)	49
Eco72I	CACGTG	1 cut(s)	635
Eco88I	CYCGRG	1 cut(s)	680
EcoRI	GAATTC	1 cut(s)	704
EcoRII	CCWGG	1 cut(s)	51
EcoRV	GATATC	1 cut(s)	343
EcoT14I	CCWWGG	3 cut(s)	840, 917, 930
EcoT22I	ATGCAT	1 cut(s)	661
ErhI	CCWWGG	3 cut(s)	840, 917, 930
Esp3I	CGTCTC	1 cut(s)	775
FaeI	CATG	5 cut(s)	142, 244, 547, 663, 892
FaiI	YATR	9 cut(s)	140, 164, 242, 263, 362, 545, 661, 756, 890
FaqI	GGGAC	5 cut(s)	137, 394, 704, 749, 777
FatI	CATG	5 cut(s)	138, 240, 543, 659, 888
FauI	CCCGC	1 cut(s)	370
FbaI	TGATCA	1 cut(s)	540
FokI	GGATG	7 cut(s)	160, 164, 208, 420, 457, 741, 912
FspBI	CTAG	4 cut(s)	581, 647, 806, 833
GsaI	CCCAGC	1 cut(s)	780
HaeIII	GGCC	2 cut(s)	56, 665
HapII	CCGG	3 cut(s)	159, 713, 795
HgaI	GACGC	2 cut(s)	218, 479
Hin1II	CATG	5 cut(s)	142, 244, 547, 663, 892
HindIII	AAGCTT	1 cut(s)	594
HinfI	GANTC	3 cut(s)	67, 251, 621
HpaII	CCGG	3 cut(s)	159, 713, 795
HphI	GGTGA	2 cut(s)	749, 809
Hpy166II	GTNNAC	2 cut(s)	49, 886
Hpy188I	TCNGA	3 cut(s)	234, 256, 601
Hpy188III	TCNNGA	2 cut(s)	437, 590
Hpy8I	GTNNAC	2 cut(s)	49, 886
Hpy99I	CGWCG	3 cut(s)	227, 234, 341
HpyAV	CCTTC	2 cut(s)	83, 890
HpyCH4III	ACNGT	2 cut(s)	260, 816
HpyCH4IV	ACGT	1 cut(s)	634
HpyCH4V	TGCA	8 cut(s)	107, 142, 211, 310, 532, 659, 824, 945
HpyF10VI	GCNNNNNNNGC	6 cut(s)	139, 217, 226, 511, 583, 951
HpyF3I	CTNAG	3 cut(s)	63, 71, 462
HpySE526I	ACGT	1 cut(s)	634
Hsp92II	CATG	5 cut(s)	142, 244, 547, 663, 892
Ksp22I	TGATCA	1 cut(s)	540
Kzo9I	GATC	4 cut(s)	265, 487, 540, 921
LmnI	GCTCC	3 cut(s)	97, 582, 732
LweI	GCATC	5 cut(s)	116, 177, 363, 401, 633
MaeI	CTAG	4 cut(s)	581, 647, 806, 833
MaeII	ACGT	1 cut(s)	634
MaeIII	GTNAC	2 cut(s)	154, 303
MalI	GATC	4 cut(s)	267, 489, 542, 923
MbiI	CCGCTC	2 cut(s)	577, 735
MboI	GATC	4 cut(s)	265, 487, 540, 921
MboII	GAAGA	6 cut(s)	50, 181, 184, 497, 614, 887
MflI	RGATCY	1 cut(s)	921
MluCI	AATT	2 cut(s)	523, 704
MlyI	GAGTC	1 cut(s)	260
MmeI	TCCRAC	2 cut(s)	212, 460
Mph1103I	ATGCAT	1 cut(s)	661
MseI	TTAA	2 cut(s)	273, 654
MslI	CAYNNNNRTG	1 cut(s)	359
MspI	CCGG	3 cut(s)	159, 713, 795
MspR9I	CCNGG	2 cut(s)	53, 795
MvaI	CCWGG	1 cut(s)	53
MwoI	GCNNNNNNNGC	6 cut(s)	139, 217, 226, 511, 583, 951
NciI	CCSGG	1 cut(s)	795
NdeII	GATC	4 cut(s)	265, 487, 540, 921
NlaIII	CATG	5 cut(s)	142, 244, 547, 663, 892
NlaIV	GGNNCC	2 cut(s)	838, 923
NmeAIII	GCCGAG	1 cut(s)	82
NmuCI	GTSAC	1 cut(s)	303
NsiI	ATGCAT	1 cut(s)	661
PcsI	WCGNNNNNNNCGW	1 cut(s)	395
PfeI	GAWTC	2 cut(s)	67, 621
PflMI	CCANNNNNTGG	1 cut(s)	931
PinAI	ACCGGT	1 cut(s)	158
PleI	GAGTC	1 cut(s)	259
PmaCI	CACGTG	1 cut(s)	635
PmlI	CACGTG	1 cut(s)	635
PpsI	GAGTC	1 cut(s)	259
Ppu21I	YACGTR	1 cut(s)	635
PshAI	GACNNNNGTC	1 cut(s)	228
PshBI	ATTAAT	1 cut(s)	654
Psp6I	CCWGG	1 cut(s)	51
PspCI	CACGTG	1 cut(s)	635
PspFI	CCCAGC	1 cut(s)	776
PspGI	CCWGG	1 cut(s)	51
PspN4I	GGNNCC	2 cut(s)	838, 923
PspPI	GGNCC	2 cut(s)	49, 663
PsuI	RGATCY	1 cut(s)	921
RsaI	GTAC	2 cut(s)	456, 563
RsaNI	GTAC	2 cut(s)	455, 562
RseI	CAYNNNNRTG	1 cut(s)	359
SaqAI	TTAA	2 cut(s)	273, 654
Sau3AI	GATC	4 cut(s)	265, 487, 540, 921
Sau96I	GGNCC	2 cut(s)	49, 663
SchI	GAGTC	1 cut(s)	260
ScrFI	CCNGG	2 cut(s)	53, 795
SfaNI	GCATC	5 cut(s)	116, 177, 363, 401, 633
SinI	GGWCC	1 cut(s)	49
SmiMI	CAYNNNNRTG	1 cut(s)	359
Sse9I	AATT	2 cut(s)	523, 704
SsiI	CCGC	4 cut(s)	190, 377, 575, 735
SspMI	CTAG	4 cut(s)	581, 647, 806, 833
StyD4I	CCNGG	2 cut(s)	51, 793
StyI	CCWWGG	3 cut(s)	840, 917, 930
TaaI	ACNGT	2 cut(s)	260, 816
TaiI	ACGT	1 cut(s)	637
TaqI	TCGA	4 cut(s)	110, 222, 249, 624
TasI	AATT	2 cut(s)	523, 704
TfiI	GAWTC	2 cut(s)	67, 621
Tru1I	TTAA	2 cut(s)	273, 654
Tru9I	TTAA	2 cut(s)	273, 654
TscAI	CASTG	2 cut(s)	149, 312
TseFI	GTSAC	1 cut(s)	303
Tsp45I	GTSAC	1 cut(s)	303
TspDTI	ATGAA	2 cut(s)	127, 461
TspRI	CASTG	2 cut(s)	149, 312
Van91I	CCANNNNNTGG	1 cut(s)	931
VpaK11BI	GGWCC	1 cut(s)	49
VspI	ATTAAT	1 cut(s)	654
XapI	RAATTY	1 cut(s)	704
XspI	CTAG	4 cut(s)	581, 647, 806, 833
Zsp2I	ATGCAT	1 cut(s)	661

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.