Rmu_ssc0000331.1_g000001

Belongs to the cytochrome P450 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000331.1
OG0005176
Physical Location & Seq
Forward (+)
36 .. 2118
2083 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 978 bp
atgacgatgacgatggtggggaggaggttctacggcgaagatgtggtggaccaggccgaggctaagaatctcagggaggtcattagggaaggtgtggagctatctgcatcgacaaacttgggggactttttgccgttcatgcagtggatggatgttaccggtatggagaagaagatggtggggttgatgcggaggatggacaagttcttgcagggtttgctcgacgagcgtcggaaaatcatggcagtcgagtctgacggtatagatcaggttaagagtaagttgatgattgataacttattgtcactgcaagaagcagaacagaaatactacaccgacgatatcatcaagggcatcattatggtattgctggtggcggggactgacacggcatcaacgacaatggaatgggcaatggctctattgctaaaccatccagaaaggatgaacaaagtacgagctgagatagacgcaaaggttggagaagatcgtctattgaatgagcaagacttgccgaagttgaattacttgcaaaatgtgatcatggaggcacttcgcttgtacccacctgttccgctcctagtgcctcgtgaagcttccgaagattgtgtggttgggggattcgatgttccacgtggcacgatgctagtgattaatgcatgggccattcacagagaccccgagttttgggacgacccgacagaattcaagccggagaggtttgagggatggagcggtgagggtggcgagggatataaggtagtcccgttcggtgctgggagacgaggttgtcccggtgatgttctagccaaacggtttattgcattggcactaggaaccttggttcagtcgtttgagtgggggaggattagtgaagagaaagtggacatgagtgaagggttgggtcttacaatgccaaggatccatcccttggaggctttgtgcaaaccacgccctgttattgaggcttcaatgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00140 ko00905 ko00943 ko01100 ko01110 ko04913 ko04917 ko04927 ko04934 map00140 map00905 map00943 map01100 map01110 map04913 map04917 map04927 map04934
Pfam Domains
Protein Families
p450

Protein Analysis

325

Amino Acids

36.67

Weight (kDa)

4.92

Isoelectric Point (pI)

37.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 1 - 305 1.5e-74 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 789
AccB7I CCANNNNNTGG 1 cut(s) 931
AccBSI CCGCTC 2 cut(s) 577, 735
AciI CCGC 4 cut(s) 190, 377, 575, 735
AclWI GGATC 2 cut(s) 916, 929
AcsI RAATTY 1 cut(s) 704
AcvI CACGTG 1 cut(s) 635
AfaI GTAC 2 cut(s) 456, 563
AfiI CCNNNNNNNGG 3 cut(s) 58, 687, 931
AgeI ACCGGT 1 cut(s) 158
AgsI TTSAA 4 cut(s) 499, 523, 709, 972
AjnI CCWGG 1 cut(s) 51
AloI GAACNNNNNNTCC 4 cut(s) 612, 644, 828, 860
AluBI AGCT 3 cut(s) 100, 461, 596
AluI AGCT 3 cut(s) 100, 461, 596
Alw26I GTCTC 2 cut(s) 669, 775
AlwI GGATC 2 cut(s) 916, 929
Ama87I CYCGRG 1 cut(s) 680
AoxI GGCC 2 cut(s) 54, 663
ApoI RAATTY 1 cut(s) 704
AseI ATTAAT 1 cut(s) 654
AsiGI ACCGGT 1 cut(s) 158
AspS9I GGNCC 2 cut(s) 49, 663
AsuC2I CCSGG 1 cut(s) 795
AsuHPI GGTGA 2 cut(s) 749, 809
AvaI CYCGRG 1 cut(s) 680
AvaII GGWCC 1 cut(s) 49
BamHI GGATCC 1 cut(s) 921
BarI GAAGNNNNNNTAC 2 cut(s) 509, 541
BauI CACGAG 1 cut(s) 588
BbrPI CACGTG 1 cut(s) 635
BccI CCATC 7 cut(s) 7, 142, 169, 190, 441, 723, 933
BceAI ACGGC 3 cut(s) 49, 118, 405
BciT130I CCWGG 1 cut(s) 53
BclI TGATCA 1 cut(s) 540
BcnI CCSGG 1 cut(s) 795
BcoDI GTCTC 2 cut(s) 669, 775
BfaI CTAG 4 cut(s) 581, 647, 806, 833
Bme1390I CCNGG 2 cut(s) 53, 795
Bme18I GGWCC 1 cut(s) 49
BmeT110I CYCGRG 1 cut(s) 680
BmgT120I GGNCC 2 cut(s) 49, 663
BmiI GGNNCC 2 cut(s) 838, 923
BmrFI CCNGG 2 cut(s) 53, 795
BmsI GCATC 5 cut(s) 116, 177, 363, 401, 633
BoxI GACNNNNGTC 1 cut(s) 228
BpuMI CCSGG 1 cut(s) 795
BsaAI YACGTR 1 cut(s) 635
BsaI GGTCTC 1 cut(s) 669
BsaJI CCNNGG 4 cut(s) 57, 840, 917, 930
BsaWI WCCGGW 1 cut(s) 158
BsaXI ACNNNNNCTCC 6 cut(s) 772, 802, 856, 886, 926, 956
Bsc4I CCNNNNNNNGG 3 cut(s) 58, 687, 931
Bse118I RCCGGY 1 cut(s) 158
Bse3DI GCAATG 1 cut(s) 420
BseBI CCWGG 1 cut(s) 53
BseDI CCNNGG 4 cut(s) 57, 840, 917, 930
BseGI GGATG 7 cut(s) 153, 157, 201, 433, 450, 734, 925
BseLI CCNNNNNNNGG 3 cut(s) 58, 687, 931
BseMI GCAATG 1 cut(s) 420
BseMII CTCAG 2 cut(s) 85, 453
BseRI GAGGAG 1 cut(s) 37
BseYI CCCAGC 1 cut(s) 776
BshFI GGCC 2 cut(s) 56, 665
BshTI ACCGGT 1 cut(s) 158
BsiHKCI CYCGRG 1 cut(s) 680
BsiSI CCGG 3 cut(s) 159, 713, 795
BslFI GGGAC 5 cut(s) 137, 394, 704, 749, 777
BslI CCNNNNNNNGG 3 cut(s) 58, 687, 931
BsmAI GTCTC 2 cut(s) 669, 775
BsmBI CGTCTC 1 cut(s) 775
BsmFI GGGAC 5 cut(s) 137, 394, 704, 749, 777
BsnI GGCC 2 cut(s) 56, 665
Bso31I GGTCTC 1 cut(s) 669
BsoBI CYCGRG 1 cut(s) 680
Bsp143I GATC 4 cut(s) 265, 487, 540, 921
BspACI CCGC 4 cut(s) 190, 377, 575, 735
BspANI GGCC 2 cut(s) 56, 665
BspCNI CTCAG 2 cut(s) 84, 454
BspLI GGNNCC 2 cut(s) 838, 923
BspPI GGATC 2 cut(s) 916, 929
BspTNI GGTCTC 1 cut(s) 669
BsrBI CCGCTC 2 cut(s) 577, 735
BsrDI GCAATG 1 cut(s) 420
BsrFI RCCGGY 1 cut(s) 158
BssAI RCCGGY 1 cut(s) 158
BssECI CCNNGG 4 cut(s) 57, 840, 917, 930
BssMI GATC 4 cut(s) 265, 487, 540, 921
BssSI CACGAG 1 cut(s) 588
BssT1I CCWWGG 3 cut(s) 840, 917, 930
Bst2BI CACGAG 1 cut(s) 588
Bst2UI CCWGG 1 cut(s) 53
Bst4CI ACNGT 2 cut(s) 260, 816
Bst6I CTCTTC 1 cut(s) 870
BstAPI GCANNNNNTGC 2 cut(s) 217, 511
BstBAI YACGTR 1 cut(s) 635
BstDEI CTNAG 3 cut(s) 63, 71, 462
BstF5I GGATG 7 cut(s) 153, 157, 201, 433, 450, 734, 925
BstKTI GATC 4 cut(s) 268, 490, 543, 924
BstMAI GTCTC 2 cut(s) 669, 775
BstMBI GATC 4 cut(s) 265, 487, 540, 921
BstMWI GCNNNNNNNGC 6 cut(s) 139, 217, 226, 511, 583, 951
BstNI CCWGG 1 cut(s) 53
BstPAI GACNNNNGTC 1 cut(s) 228
BstSCI CCNGG 2 cut(s) 51, 793
BstX2I RGATCY 1 cut(s) 921
BstYI RGATCY 1 cut(s) 921
BsuRI GGCC 2 cut(s) 56, 665
BtsCI GGATG 7 cut(s) 153, 157, 201, 433, 450, 734, 925
BtsI GCAGTG 2 cut(s) 149, 305
BtsIMutI CAGTG 2 cut(s) 149, 305
Cfr10I RCCGGY 1 cut(s) 158
Cfr13I GGNCC 2 cut(s) 49, 663
CseI GACGC 2 cut(s) 218, 479
Csp6I GTAC 2 cut(s) 455, 562
CspAI ACCGGT 1 cut(s) 158
CviAII CATG 5 cut(s) 139, 241, 544, 660, 889
CviQI GTAC 2 cut(s) 455, 562
DdeI CTNAG 3 cut(s) 63, 71, 462
DpnI GATC 4 cut(s) 267, 489, 542, 923
DpnII GATC 4 cut(s) 265, 487, 540, 921
DrdI GACNNNNNNGTC 1 cut(s) 789
DseDI GACNNNNNNGTC 1 cut(s) 789
Eam1104I CTCTTC 1 cut(s) 870
EarI CTCTTC 1 cut(s) 870
Eco130I CCWWGG 3 cut(s) 840, 917, 930
Eco31I GGTCTC 1 cut(s) 669
Eco32I GATATC 1 cut(s) 343
Eco47I GGWCC 1 cut(s) 49
Eco72I CACGTG 1 cut(s) 635
Eco88I CYCGRG 1 cut(s) 680
EcoRI GAATTC 1 cut(s) 704
EcoRII CCWGG 1 cut(s) 51
EcoRV GATATC 1 cut(s) 343
EcoT14I CCWWGG 3 cut(s) 840, 917, 930
EcoT22I ATGCAT 1 cut(s) 661
ErhI CCWWGG 3 cut(s) 840, 917, 930
Esp3I CGTCTC 1 cut(s) 775
FaeI CATG 5 cut(s) 142, 244, 547, 663, 892
FaiI YATR 9 cut(s) 140, 164, 242, 263, 362, 545, 661, 756, 890
FaqI GGGAC 5 cut(s) 137, 394, 704, 749, 777
FatI CATG 5 cut(s) 138, 240, 543, 659, 888
FauI CCCGC 1 cut(s) 370
FbaI TGATCA 1 cut(s) 540
FokI GGATG 7 cut(s) 160, 164, 208, 420, 457, 741, 912
FspBI CTAG 4 cut(s) 581, 647, 806, 833
GsaI CCCAGC 1 cut(s) 780
HaeIII GGCC 2 cut(s) 56, 665
HapII CCGG 3 cut(s) 159, 713, 795
HgaI GACGC 2 cut(s) 218, 479
Hin1II CATG 5 cut(s) 142, 244, 547, 663, 892
HindIII AAGCTT 1 cut(s) 594
HinfI GANTC 3 cut(s) 67, 251, 621
HpaII CCGG 3 cut(s) 159, 713, 795
HphI GGTGA 2 cut(s) 749, 809
Hpy166II GTNNAC 2 cut(s) 49, 886
Hpy188I TCNGA 3 cut(s) 234, 256, 601
Hpy188III TCNNGA 2 cut(s) 437, 590
Hpy8I GTNNAC 2 cut(s) 49, 886
Hpy99I CGWCG 3 cut(s) 227, 234, 341
HpyAV CCTTC 2 cut(s) 83, 890
HpyCH4III ACNGT 2 cut(s) 260, 816
HpyCH4IV ACGT 1 cut(s) 634
HpyCH4V TGCA 8 cut(s) 107, 142, 211, 310, 532, 659, 824, 945
HpyF10VI GCNNNNNNNGC 6 cut(s) 139, 217, 226, 511, 583, 951
HpyF3I CTNAG 3 cut(s) 63, 71, 462
HpySE526I ACGT 1 cut(s) 634
Hsp92II CATG 5 cut(s) 142, 244, 547, 663, 892
Ksp22I TGATCA 1 cut(s) 540
Kzo9I GATC 4 cut(s) 265, 487, 540, 921
LmnI GCTCC 3 cut(s) 97, 582, 732
LweI GCATC 5 cut(s) 116, 177, 363, 401, 633
MaeI CTAG 4 cut(s) 581, 647, 806, 833
MaeII ACGT 1 cut(s) 634
MaeIII GTNAC 2 cut(s) 154, 303
MalI GATC 4 cut(s) 267, 489, 542, 923
MbiI CCGCTC 2 cut(s) 577, 735
MboI GATC 4 cut(s) 265, 487, 540, 921
MboII GAAGA 6 cut(s) 50, 181, 184, 497, 614, 887
MflI RGATCY 1 cut(s) 921
MluCI AATT 2 cut(s) 523, 704
MlyI GAGTC 1 cut(s) 260
MmeI TCCRAC 2 cut(s) 212, 460
Mph1103I ATGCAT 1 cut(s) 661
MseI TTAA 2 cut(s) 273, 654
MslI CAYNNNNRTG 1 cut(s) 359
MspI CCGG 3 cut(s) 159, 713, 795
MspR9I CCNGG 2 cut(s) 53, 795
MvaI CCWGG 1 cut(s) 53
MwoI GCNNNNNNNGC 6 cut(s) 139, 217, 226, 511, 583, 951
NciI CCSGG 1 cut(s) 795
NdeII GATC 4 cut(s) 265, 487, 540, 921
NlaIII CATG 5 cut(s) 142, 244, 547, 663, 892
NlaIV GGNNCC 2 cut(s) 838, 923
NmeAIII GCCGAG 1 cut(s) 82
NmuCI GTSAC 1 cut(s) 303
NsiI ATGCAT 1 cut(s) 661
PcsI WCGNNNNNNNCGW 1 cut(s) 395
PfeI GAWTC 2 cut(s) 67, 621
PflMI CCANNNNNTGG 1 cut(s) 931
PinAI ACCGGT 1 cut(s) 158
PleI GAGTC 1 cut(s) 259
PmaCI CACGTG 1 cut(s) 635
PmlI CACGTG 1 cut(s) 635
PpsI GAGTC 1 cut(s) 259
Ppu21I YACGTR 1 cut(s) 635
PshAI GACNNNNGTC 1 cut(s) 228
PshBI ATTAAT 1 cut(s) 654
Psp6I CCWGG 1 cut(s) 51
PspCI CACGTG 1 cut(s) 635
PspFI CCCAGC 1 cut(s) 776
PspGI CCWGG 1 cut(s) 51
PspN4I GGNNCC 2 cut(s) 838, 923
PspPI GGNCC 2 cut(s) 49, 663
PsuI RGATCY 1 cut(s) 921
RsaI GTAC 2 cut(s) 456, 563
RsaNI GTAC 2 cut(s) 455, 562
RseI CAYNNNNRTG 1 cut(s) 359
SaqAI TTAA 2 cut(s) 273, 654
Sau3AI GATC 4 cut(s) 265, 487, 540, 921
Sau96I GGNCC 2 cut(s) 49, 663
SchI GAGTC 1 cut(s) 260
ScrFI CCNGG 2 cut(s) 53, 795
SfaNI GCATC 5 cut(s) 116, 177, 363, 401, 633
SinI GGWCC 1 cut(s) 49
SmiMI CAYNNNNRTG 1 cut(s) 359
Sse9I AATT 2 cut(s) 523, 704
SsiI CCGC 4 cut(s) 190, 377, 575, 735
SspMI CTAG 4 cut(s) 581, 647, 806, 833
StyD4I CCNGG 2 cut(s) 51, 793
StyI CCWWGG 3 cut(s) 840, 917, 930
TaaI ACNGT 2 cut(s) 260, 816
TaiI ACGT 1 cut(s) 637
TaqI TCGA 4 cut(s) 110, 222, 249, 624
TasI AATT 2 cut(s) 523, 704
TfiI GAWTC 2 cut(s) 67, 621
Tru1I TTAA 2 cut(s) 273, 654
Tru9I TTAA 2 cut(s) 273, 654
TscAI CASTG 2 cut(s) 149, 312
TseFI GTSAC 1 cut(s) 303
Tsp45I GTSAC 1 cut(s) 303
TspDTI ATGAA 2 cut(s) 127, 461
TspRI CASTG 2 cut(s) 149, 312
Van91I CCANNNNNTGG 1 cut(s) 931
VpaK11BI GGWCC 1 cut(s) 49
VspI ATTAAT 1 cut(s) 654
XapI RAATTY 1 cut(s) 704
XspI CTAG 4 cut(s) 581, 647, 806, 833
Zsp2I ATGCAT 1 cut(s) 661
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.