Rroxscaffold_1G00003190

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
3684832 .. 3686578
1747 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00003190.1

Sequence Viewer

Length: 294 bp
ATGTGTTCCCAATCCTTCGCCTGTTTCAGATCAGAGCTCTCCAATGAAGGGGATAGCAGAAGATTTGAAACATCAAATGGTAAAACTTGTTATACGAAGTCAAGAAAAAGAAAAGGAATGAAGGATGATAAAGATCCTTCCGAATTTCCATCTATTCCAGAGGAACCCTCTTATGAAAGGAGACCAGATGATCCTCATAAATCAAAGCTTAGATCATGCAAAGGAAAAGAAGTGAAGGCAAATACTCTTGCTATTAAGGATGATGAAGATGCGCCCCTTATTATGTCATTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

11.07

Weight (kDa)

8.35

Isoelectric Point (pI)

76.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 128, 185
AcsI RAATTY 1 cut(s) 143
AfiI CCNNNNNNNGG 1 cut(s) 48
AgsI TTSAA 1 cut(s) 68
AluBI AGCT 2 cut(s) 37, 208
AluI AGCT 2 cut(s) 37, 208
Alw21I GWGCWC 1 cut(s) 39
Alw26I GTCTC 1 cut(s) 175
AlwI GGATC 2 cut(s) 128, 185
ApoI RAATTY 1 cut(s) 143
AspLEI GCGC 1 cut(s) 274
BanII GRGCYC 1 cut(s) 39
Bbv12I GWGCWC 1 cut(s) 39
BccI CCATC 1 cut(s) 157
BcoDI GTCTC 1 cut(s) 175
BmiI GGNNCC 1 cut(s) 165
BmsI GCATC 1 cut(s) 259
BplI GAGNNNNNCTC 2 cut(s) 152, 184
BsaBI GATNNNNATC 1 cut(s) 132
BsaI GGTCTC 1 cut(s) 175
Bsc4I CCNNNNNNNGG 1 cut(s) 48
Bse8I GATNNNNATC 1 cut(s) 132
BseGI GGATG 2 cut(s) 130, 265
BseJI GATNNNNATC 1 cut(s) 132
BseLI CCNNNNNNNGG 1 cut(s) 48
BsiHKAI GWGCWC 1 cut(s) 39
BslI CCNNNNNNNGG 1 cut(s) 48
BsmAI GTCTC 1 cut(s) 175
Bso31I GGTCTC 1 cut(s) 175
Bsp1286I GDGCHC 1 cut(s) 39
Bsp143I GATC 4 cut(s) 29, 133, 190, 212
BspLI GGNNCC 1 cut(s) 165
BspPI GGATC 2 cut(s) 128, 185
BspTNI GGTCTC 1 cut(s) 175
BssMI GATC 4 cut(s) 29, 133, 190, 212
BstDEI CTNAG 1 cut(s) 209
BstF5I GGATG 2 cut(s) 130, 265
BstHHI GCGC 1 cut(s) 274
BstKTI GATC 4 cut(s) 32, 136, 193, 215
BstMAI GTCTC 1 cut(s) 175
BstMBI GATC 4 cut(s) 29, 133, 190, 212
BstX2I RGATCY 1 cut(s) 133
BstYI RGATCY 1 cut(s) 133
BtsCI GGATG 2 cut(s) 130, 265
CfoI GCGC 1 cut(s) 274
CviAII CATG 1 cut(s) 216
CviJI RGCY 2 cut(s) 37, 208
CviKI_1 RGCY 2 cut(s) 37, 208
DdeI CTNAG 1 cut(s) 209
DpnI GATC 4 cut(s) 31, 135, 192, 214
DpnII GATC 4 cut(s) 29, 133, 190, 212
Ecl136II GAGCTC 1 cut(s) 37
Eco24I GRGCYC 1 cut(s) 39
Eco31I GGTCTC 1 cut(s) 175
Eco53kI GAGCTC 1 cut(s) 37
EcoICRI GAGCTC 1 cut(s) 37
EcoT38I GRGCYC 1 cut(s) 39
FaeI CATG 1 cut(s) 219
FaiI YATR 6 cut(s) 93, 174, 198, 217, 284, 292
FatI CATG 1 cut(s) 215
FokI GGATG 2 cut(s) 137, 272
FriOI GRGCYC 1 cut(s) 39
GlaI GCGC 1 cut(s) 273
HhaI GCGC 1 cut(s) 274
Hin1II CATG 1 cut(s) 219
Hin6I GCGC 1 cut(s) 272
HinP1I GCGC 1 cut(s) 272
HindIII AAGCTT 1 cut(s) 206
Hpy188I TCNGA 3 cut(s) 29, 34, 142
Hpy188III TCNNGA 2 cut(s) 102, 158
HpyAV CCTTC 5 cut(s) 25, 41, 115, 147, 229
HpyCH4V TGCA 1 cut(s) 219
HpyF3I CTNAG 1 cut(s) 209
Hsp92II CATG 1 cut(s) 219
HspAI GCGC 1 cut(s) 272
Kzo9I GATC 4 cut(s) 29, 133, 190, 212
LpnPI CCDG 3 cut(s) 34, 171, 198
LweI GCATC 1 cut(s) 259
MalI GATC 4 cut(s) 31, 135, 192, 214
MboI GATC 4 cut(s) 29, 133, 190, 212
MboII GAAGA 2 cut(s) 72, 278
MflI RGATCY 1 cut(s) 133
MhlI GDGCHC 1 cut(s) 39
MluCI AATT 1 cut(s) 143
MnlI CCTC 3 cut(s) 154, 178, 204
MseI TTAA 1 cut(s) 255
NdeII GATC 4 cut(s) 29, 133, 190, 212
NlaIII CATG 1 cut(s) 219
NlaIV GGNNCC 1 cut(s) 165
Psp124BI GAGCTC 1 cut(s) 39
PspN4I GGNNCC 1 cut(s) 165
PsuI RGATCY 1 cut(s) 133
SacI GAGCTC 1 cut(s) 39
SaqAI TTAA 1 cut(s) 255
Sau3AI GATC 4 cut(s) 29, 133, 190, 212
SduI GDGCHC 1 cut(s) 39
SetI ASST 2 cut(s) 39, 210
SfaNI GCATC 1 cut(s) 259
SgeI CNNG 7 cut(s) 33, 99, 114, 170, 197, 228, 260
Sse9I AATT 1 cut(s) 143
SstI GAGCTC 1 cut(s) 39
TasI AATT 1 cut(s) 143
Tru1I TTAA 1 cut(s) 255
Tru9I TTAA 1 cut(s) 255
TspDTI ATGAA 4 cut(s) 60, 134, 189, 279
XapI RAATTY 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.