Rh2CG485500

snRNA-activating protein complex

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
65126330 .. 65133410
7081 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG485500.1

Sequence Viewer

Length: 330 bp
ATGGATGATGAAGATCCTTCCGAACTTCCATCTATTCCAGAGGAACCCCCTTATGAATGGAGAGGAGACAATCCTGAGACATCAAATGAAAAATATTATATAACGTATTCAAGGAAAAGAAGAAGAATATTGAAGGACGACGAAGGTGCTCTAAATGTTTTGCCGATTTCAGAAAAGCCTGTCAAGGAAAGGAGACCAGATGATCCTCATAAATCAGAACTTAGATCATGCAAAGGAAACGAAGTGAAGACAAATAATCTTGCTATTAAGGATGATGAAGATACCCCCCATCTTTTGACTAGTTCGGAAGAGCCCTTTAATGAAAGGTAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

109

Amino Acids

12.74

Weight (kDa)

4.76

Isoelectric Point (pI)

71.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 8, 197
AgsI TTSAA 2 cut(s) 111, 133
AhlI ACTAGT 1 cut(s) 299
Alw21I GWGCWC 1 cut(s) 151
Alw26I GTCTC 3 cut(s) 60, 71, 187
AlwI GGATC 2 cut(s) 8, 197
BanII GRGCYC 1 cut(s) 315
BbsI GAAGAC 1 cut(s) 254
Bbv12I GWGCWC 1 cut(s) 151
BccI CCATC 2 cut(s) 37, 297
BcgI CGANNNNNNTGC 2 cut(s) 128, 162
BcoDI GTCTC 3 cut(s) 60, 71, 187
BcuI ACTAGT 1 cut(s) 299
BfaI CTAG 1 cut(s) 300
BmiI GGNNCC 1 cut(s) 45
BpiI GAAGAC 1 cut(s) 254
BsaBI GATNNNNATC 1 cut(s) 12
BsaI GGTCTC 1 cut(s) 187
Bse8I GATNNNNATC 1 cut(s) 12
BseGI GGATG 2 cut(s) 10, 277
BseJI GATNNNNATC 1 cut(s) 12
BseMII CTCAG 1 cut(s) 66
BseRI GAGGAG 1 cut(s) 78
BsiHKAI GWGCWC 1 cut(s) 151
BsmAI GTCTC 3 cut(s) 60, 71, 187
Bso31I GGTCTC 1 cut(s) 187
Bsp1286I GDGCHC 2 cut(s) 151, 315
Bsp143I GATC 3 cut(s) 13, 202, 224
BspCNI CTCAG 1 cut(s) 67
BspLI GGNNCC 1 cut(s) 45
BspPI GGATC 2 cut(s) 8, 197
BspQI GCTCTTC 1 cut(s) 303
BspTNI GGTCTC 1 cut(s) 187
BssMI GATC 3 cut(s) 13, 202, 224
Bst6I CTCTTC 1 cut(s) 303
BstDEI CTNAG 2 cut(s) 75, 221
BstF5I GGATG 2 cut(s) 10, 277
BstKTI GATC 3 cut(s) 16, 205, 227
BstMAI GTCTC 3 cut(s) 60, 71, 187
BstMBI GATC 3 cut(s) 13, 202, 224
BstV2I GAAGAC 1 cut(s) 254
BstX2I RGATCY 1 cut(s) 13
BstYI RGATCY 1 cut(s) 13
BtsCI GGATG 2 cut(s) 10, 277
CviAII CATG 1 cut(s) 228
CviJI RGCY 2 cut(s) 178, 313
CviKI_1 RGCY 2 cut(s) 178, 313
DdeI CTNAG 2 cut(s) 75, 221
DpnI GATC 3 cut(s) 15, 204, 226
DpnII GATC 3 cut(s) 13, 202, 224
Eam1104I CTCTTC 1 cut(s) 303
EarI CTCTTC 1 cut(s) 303
Eco24I GRGCYC 1 cut(s) 315
Eco31I GGTCTC 1 cut(s) 187
EcoT38I GRGCYC 1 cut(s) 315
FaeI CATG 1 cut(s) 231
FaiI YATR 5 cut(s) 54, 99, 101, 210, 229
FatI CATG 1 cut(s) 227
FokI GGATG 2 cut(s) 17, 284
FriOI GRGCYC 1 cut(s) 315
FspBI CTAG 1 cut(s) 300
Hin1II CATG 1 cut(s) 231
Hpy188I TCNGA 4 cut(s) 22, 172, 217, 307
Hpy188III TCNNGA 2 cut(s) 38, 74
Hpy99I CGWCG 1 cut(s) 143
HpyAV CCTTC 3 cut(s) 27, 127, 137
HpyCH4IV ACGT 1 cut(s) 104
HpyCH4V TGCA 1 cut(s) 231
HpyF3I CTNAG 2 cut(s) 75, 221
HpySE526I ACGT 1 cut(s) 104
Hsp92II CATG 1 cut(s) 231
Kzo9I GATC 3 cut(s) 13, 202, 224
LguI GCTCTTC 1 cut(s) 303
LpnPI CCDG 4 cut(s) 51, 87, 192, 210
MaeI CTAG 1 cut(s) 300
MaeII ACGT 1 cut(s) 104
MalI GATC 3 cut(s) 15, 204, 226
MboI GATC 3 cut(s) 13, 202, 224
MboII GAAGA 6 cut(s) 23, 132, 135, 259, 290, 320
MflI RGATCY 1 cut(s) 13
MhlI GDGCHC 2 cut(s) 151, 315
MnlI CCTC 3 cut(s) 34, 56, 216
MseI TTAA 2 cut(s) 267, 318
NdeII GATC 3 cut(s) 13, 202, 224
NlaIII CATG 1 cut(s) 231
NlaIV GGNNCC 1 cut(s) 45
PciSI GCTCTTC 1 cut(s) 303
PspN4I GGNNCC 1 cut(s) 45
PsuI RGATCY 1 cut(s) 13
SapI GCTCTTC 1 cut(s) 303
SaqAI TTAA 2 cut(s) 267, 318
Sau3AI GATC 3 cut(s) 13, 202, 224
SduI GDGCHC 2 cut(s) 151, 315
SetI ASST 3 cut(s) 107, 148, 329
SgeI CNNG 9 cut(s) 50, 86, 123, 191, 196, 209, 240, 272, 312
SpeI ACTAGT 1 cut(s) 299
SspI AATATT 2 cut(s) 95, 129
SspMI CTAG 1 cut(s) 300
TaiI ACGT 1 cut(s) 107
Tru1I TTAA 2 cut(s) 267, 318
Tru9I TTAA 2 cut(s) 267, 318
TspDTI ATGAA 4 cut(s) 24, 69, 102, 291
XspI CTAG 1 cut(s) 300
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.