Rh5CG469600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0006966
Physical Location & Seq
Forward (+)
65476536 .. 65477770
1235 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG469600.1

Sequence Viewer

Length: 210 bp
ATGTGTTCCCAATCCTTCGCCTGTTTCAGATTAGAGCTCTCCAATGAAGGGATAGCAGAAGATCCTGAGACATCAAATGGTAAAGCTTGTTATACGAAGTCAAGAAAAAGAAAAGGAATGAAGGATGATGAAGATCCTTCCAAACTTCCATCTATTCTAGAGGAAGCCCCTTATGAAAGGCATTTGTTCTTTTATCATGGTAGGCGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

8.0

Weight (kDa)

6.72

Isoelectric Point (pI)

72.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 56, 128
AfiI CCNNNNNNNGG 1 cut(s) 48
AluBI AGCT 2 cut(s) 37, 86
AluI AGCT 2 cut(s) 37, 86
Alw21I GWGCWC 1 cut(s) 39
Alw26I GTCTC 1 cut(s) 62
AlwI GGATC 2 cut(s) 56, 128
BanII GRGCYC 1 cut(s) 39
Bbv12I GWGCWC 1 cut(s) 39
BccI CCATC 1 cut(s) 157
BcoDI GTCTC 1 cut(s) 62
BfaI CTAG 1 cut(s) 158
BsaBI GATNNNNATC 1 cut(s) 132
Bsc4I CCNNNNNNNGG 1 cut(s) 48
Bse8I GATNNNNATC 1 cut(s) 132
BseGI GGATG 1 cut(s) 130
BseJI GATNNNNATC 1 cut(s) 132
BseLI CCNNNNNNNGG 1 cut(s) 48
BseMII CTCAG 1 cut(s) 57
BsiHKAI GWGCWC 1 cut(s) 39
BslI CCNNNNNNNGG 1 cut(s) 48
BsmAI GTCTC 1 cut(s) 62
Bsp1286I GDGCHC 1 cut(s) 39
Bsp143I GATC 2 cut(s) 61, 133
BspCNI CTCAG 1 cut(s) 58
BspPI GGATC 2 cut(s) 56, 128
BssMI GATC 2 cut(s) 61, 133
BstDEI CTNAG 1 cut(s) 66
BstF5I GGATG 1 cut(s) 130
BstKTI GATC 2 cut(s) 64, 136
BstMAI GTCTC 1 cut(s) 62
BstMBI GATC 2 cut(s) 61, 133
BstX2I RGATCY 2 cut(s) 61, 133
BstYI RGATCY 2 cut(s) 61, 133
BtsCI GGATG 1 cut(s) 130
CviAII CATG 1 cut(s) 197
CviJI RGCY 3 cut(s) 37, 86, 167
CviKI_1 RGCY 3 cut(s) 37, 86, 167
DdeI CTNAG 1 cut(s) 66
DpnI GATC 2 cut(s) 63, 135
DpnII GATC 2 cut(s) 61, 133
Ecl136II GAGCTC 1 cut(s) 37
Eco24I GRGCYC 1 cut(s) 39
Eco53kI GAGCTC 1 cut(s) 37
EcoICRI GAGCTC 1 cut(s) 37
EcoT38I GRGCYC 1 cut(s) 39
FaeI CATG 1 cut(s) 200
FaiI YATR 3 cut(s) 93, 174, 198
FatI CATG 1 cut(s) 196
FokI GGATG 1 cut(s) 137
FriOI GRGCYC 1 cut(s) 39
FspBI CTAG 1 cut(s) 158
Hin1II CATG 1 cut(s) 200
HindIII AAGCTT 1 cut(s) 84
Hpy188I TCNGA 1 cut(s) 29
Hpy188III TCNNGA 3 cut(s) 65, 102, 158
HpyAV CCTTC 4 cut(s) 25, 41, 115, 147
HpyF3I CTNAG 1 cut(s) 66
Hsp92II CATG 1 cut(s) 200
Kzo9I GATC 2 cut(s) 61, 133
LpnPI CCDG 2 cut(s) 34, 78
MaeI CTAG 1 cut(s) 158
MalI GATC 2 cut(s) 63, 135
MboI GATC 2 cut(s) 61, 133
MboII GAAGA 2 cut(s) 71, 143
MflI RGATCY 2 cut(s) 61, 133
MhlI GDGCHC 1 cut(s) 39
MnlI CCTC 1 cut(s) 154
NdeII GATC 2 cut(s) 61, 133
NlaIII CATG 1 cut(s) 200
Psp124BI GAGCTC 1 cut(s) 39
PsuI RGATCY 2 cut(s) 61, 133
SacI GAGCTC 1 cut(s) 39
Sau3AI GATC 2 cut(s) 61, 133
SduI GDGCHC 1 cut(s) 39
SetI ASST 2 cut(s) 39, 88
SgeI CNNG 5 cut(s) 33, 77, 99, 114, 170
SspMI CTAG 1 cut(s) 158
SstI GAGCTC 1 cut(s) 39
TspDTI ATGAA 4 cut(s) 60, 134, 144, 189
XbaI TCTAGA 1 cut(s) 157
XspI CTAG 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.