Rw6G002720

snRNA-activating protein complex

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
Physical Location & Seq
Reverse (-)
4409687 .. 4411339
1653 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G002720.1

Sequence Viewer

Length: 294 bp
ATGTGTTCCCAATCCTTCGCCTGTTTCAGATCAGAGCCCTCCAATGAAGGGATAGCAGAAGATCCTGAGACATCAAATGGTAAAACTTGTTATACGAAGTCAAGAAAAAGAAAAGGAATGAAGGATGATGAAGATCCTTCCGAATTTCCATCTATTCCAGAGGAACCCCCTTATGAAAGGAGACCAGATGATCCTCATAAATCAAAGCTTAGATCCTGCAAAGGAAAAGAAGTGAAGGCAAATAATCTTGCTATTAAGGATGATGAAGATGCCCCCCTTATTATGTCATTATAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

10.94

Weight (kDa)

5.22

Isoelectric Point (pI)

77.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 4 cut(s) 56, 128, 185, 207
AcsI RAATTY 1 cut(s) 143
AfiI CCNNNNNNNGG 1 cut(s) 48
AluBI AGCT 1 cut(s) 208
AluI AGCT 1 cut(s) 208
Alw26I GTCTC 2 cut(s) 62, 175
AlwI GGATC 4 cut(s) 56, 128, 185, 207
ApoI RAATTY 1 cut(s) 143
BanII GRGCYC 1 cut(s) 39
BccI CCATC 1 cut(s) 157
BcoDI GTCTC 2 cut(s) 62, 175
BmiI GGNNCC 1 cut(s) 165
BmsI GCATC 1 cut(s) 259
BsaBI GATNNNNATC 1 cut(s) 132
BsaI GGTCTC 1 cut(s) 175
Bsc4I CCNNNNNNNGG 1 cut(s) 48
Bse8I GATNNNNATC 1 cut(s) 132
BseGI GGATG 2 cut(s) 130, 265
BseJI GATNNNNATC 1 cut(s) 132
BseLI CCNNNNNNNGG 1 cut(s) 48
BseMII CTCAG 1 cut(s) 57
BslI CCNNNNNNNGG 1 cut(s) 48
BsmAI GTCTC 2 cut(s) 62, 175
Bso31I GGTCTC 1 cut(s) 175
Bsp1286I GDGCHC 1 cut(s) 39
Bsp143I GATC 5 cut(s) 29, 61, 133, 190, 212
BspCNI CTCAG 1 cut(s) 58
BspLI GGNNCC 1 cut(s) 165
BspPI GGATC 4 cut(s) 56, 128, 185, 207
BspTNI GGTCTC 1 cut(s) 175
BssMI GATC 5 cut(s) 29, 61, 133, 190, 212
BstDEI CTNAG 2 cut(s) 66, 209
BstF5I GGATG 2 cut(s) 130, 265
BstKTI GATC 5 cut(s) 32, 64, 136, 193, 215
BstMAI GTCTC 2 cut(s) 62, 175
BstMBI GATC 5 cut(s) 29, 61, 133, 190, 212
BstX2I RGATCY 3 cut(s) 61, 133, 212
BstYI RGATCY 3 cut(s) 61, 133, 212
BtsCI GGATG 2 cut(s) 130, 265
CviJI RGCY 2 cut(s) 37, 208
CviKI_1 RGCY 2 cut(s) 37, 208
DdeI CTNAG 2 cut(s) 66, 209
DpnI GATC 5 cut(s) 31, 63, 135, 192, 214
DpnII GATC 5 cut(s) 29, 61, 133, 190, 212
Eco24I GRGCYC 1 cut(s) 39
Eco31I GGTCTC 1 cut(s) 175
EcoT38I GRGCYC 1 cut(s) 39
FaiI YATR 5 cut(s) 93, 174, 198, 284, 292
FokI GGATG 2 cut(s) 137, 272
FriOI GRGCYC 1 cut(s) 39
HindIII AAGCTT 1 cut(s) 206
Hpy188I TCNGA 3 cut(s) 29, 34, 142
Hpy188III TCNNGA 3 cut(s) 65, 102, 158
HpyAV CCTTC 5 cut(s) 25, 41, 115, 147, 229
HpyCH4V TGCA 1 cut(s) 219
HpyF3I CTNAG 2 cut(s) 66, 209
Kzo9I GATC 5 cut(s) 29, 61, 133, 190, 212
LpnPI CCDG 5 cut(s) 34, 78, 171, 198, 229
LweI GCATC 1 cut(s) 259
MalI GATC 5 cut(s) 31, 63, 135, 192, 214
MboI GATC 5 cut(s) 29, 61, 133, 190, 212
MboII GAAGA 3 cut(s) 71, 143, 278
MflI RGATCY 3 cut(s) 61, 133, 212
MhlI GDGCHC 1 cut(s) 39
MluCI AATT 1 cut(s) 143
MnlI CCTC 3 cut(s) 49, 154, 204
MseI TTAA 1 cut(s) 255
NdeII GATC 5 cut(s) 29, 61, 133, 190, 212
NlaIV GGNNCC 1 cut(s) 165
PspN4I GGNNCC 1 cut(s) 165
PsuI RGATCY 3 cut(s) 61, 133, 212
SaqAI TTAA 1 cut(s) 255
Sau3AI GATC 5 cut(s) 29, 61, 133, 190, 212
SduI GDGCHC 1 cut(s) 39
SetI ASST 1 cut(s) 210
SfaNI GCATC 1 cut(s) 259
SgeI CNNG 8 cut(s) 33, 77, 99, 114, 170, 197, 228, 260
Sse9I AATT 1 cut(s) 143
TasI AATT 1 cut(s) 143
Tru1I TTAA 1 cut(s) 255
Tru9I TTAA 1 cut(s) 255
TspDTI ATGAA 5 cut(s) 60, 134, 144, 189, 279
XapI RAATTY 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.