Rw5G048320

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Reverse (-)
84026548 .. 84028746
2199 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G048320.1

Sequence Viewer

Length: 264 bp
ATGGGTTTTAAGGGAGTACTTACGGATAGCAGAAGATTTGAGACATCAATTGGTAAAGCTTGCTATACGAAGTCAAGAAAAAGAAAAGGAATGAAGGATGATGAAGATCCTTCCGAATTTCCATCTATTCCAGAGGAACCCCCTTATGAAAGTTTTACACCCATAATTGGGAGACCAGATGATCCTCATAAATCAAAGCTTAGATCATGCAAAGGAAAAGAAGTGAAGGCAAATACTGTTGCTATTAAGGTGATTTTCCCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

9.8

Weight (kDa)

9.36

Isoelectric Point (pI)

59.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 101, 176
AcsI RAATTY 1 cut(s) 116
AfaI GTAC 1 cut(s) 18
AfiI CCNNNNNNNGG 2 cut(s) 167, 168
AluBI AGCT 2 cut(s) 59, 199
AluI AGCT 2 cut(s) 59, 199
Alw26I GTCTC 2 cut(s) 35, 166
AlwI GGATC 2 cut(s) 101, 176
ApoI RAATTY 1 cut(s) 116
AsuHPI GGTGA 1 cut(s) 262
BccI CCATC 1 cut(s) 130
BcoDI GTCTC 2 cut(s) 35, 166
BmcAI AGTACT 1 cut(s) 18
BmiI GGNNCC 1 cut(s) 138
BsaBI GATNNNNATC 1 cut(s) 105
BsaI GGTCTC 1 cut(s) 166
Bsc4I CCNNNNNNNGG 2 cut(s) 167, 168
Bse8I GATNNNNATC 1 cut(s) 105
BseGI GGATG 1 cut(s) 103
BseJI GATNNNNATC 1 cut(s) 105
BseLI CCNNNNNNNGG 2 cut(s) 167, 168
BslI CCNNNNNNNGG 2 cut(s) 167, 168
BsmAI GTCTC 2 cut(s) 35, 166
Bso31I GGTCTC 1 cut(s) 166
Bsp143I GATC 3 cut(s) 106, 181, 203
BspLI GGNNCC 1 cut(s) 138
BspPI GGATC 2 cut(s) 101, 176
BspTNI GGTCTC 1 cut(s) 166
BssMI GATC 3 cut(s) 106, 181, 203
Bst4CI ACNGT 1 cut(s) 238
BstC8I GCNNGC 1 cut(s) 61
BstDEI CTNAG 1 cut(s) 200
BstF5I GGATG 1 cut(s) 103
BstKTI GATC 3 cut(s) 109, 184, 206
BstMAI GTCTC 2 cut(s) 35, 166
BstMBI GATC 3 cut(s) 106, 181, 203
BstX2I RGATCY 1 cut(s) 106
BstYI RGATCY 1 cut(s) 106
BtsCI GGATG 1 cut(s) 103
Cac8I GCNNGC 1 cut(s) 61
Csp6I GTAC 1 cut(s) 17
CviAII CATG 1 cut(s) 207
CviJI RGCY 2 cut(s) 59, 199
CviKI_1 RGCY 2 cut(s) 59, 199
CviQI GTAC 1 cut(s) 17
DdeI CTNAG 1 cut(s) 200
DpnI GATC 3 cut(s) 108, 183, 205
DpnII GATC 3 cut(s) 106, 181, 203
Eco31I GGTCTC 1 cut(s) 166
FaeI CATG 1 cut(s) 210
FaiI YATR 6 cut(s) 66, 147, 164, 189, 208, 262
FatI CATG 1 cut(s) 206
FokI GGATG 1 cut(s) 110
Hin1II CATG 1 cut(s) 210
HindIII AAGCTT 2 cut(s) 57, 197
HphI GGTGA 1 cut(s) 262
Hpy188I TCNGA 1 cut(s) 115
Hpy188III TCNNGA 2 cut(s) 75, 131
HpyAV CCTTC 3 cut(s) 88, 120, 220
HpyCH4III ACNGT 1 cut(s) 238
HpyCH4V TGCA 1 cut(s) 210
HpyF3I CTNAG 1 cut(s) 200
Hsp92II CATG 1 cut(s) 210
Kzo9I GATC 3 cut(s) 106, 181, 203
LpnPI CCDG 2 cut(s) 144, 189
MalI GATC 3 cut(s) 108, 183, 205
MboI GATC 3 cut(s) 106, 181, 203
MboII GAAGA 2 cut(s) 45, 116
MfeI CAATTG 1 cut(s) 48
MflI RGATCY 1 cut(s) 106
MluCI AATT 3 cut(s) 48, 116, 165
MnlI CCTC 2 cut(s) 127, 195
MseI TTAA 2 cut(s) 9, 246
MunI CAATTG 1 cut(s) 48
NdeII GATC 3 cut(s) 106, 181, 203
NlaIII CATG 1 cut(s) 210
NlaIV GGNNCC 1 cut(s) 138
PspN4I GGNNCC 1 cut(s) 138
PsuI RGATCY 1 cut(s) 106
RsaI GTAC 1 cut(s) 18
RsaNI GTAC 1 cut(s) 17
SaqAI TTAA 2 cut(s) 9, 246
Sau3AI GATC 3 cut(s) 106, 181, 203
ScaI AGTACT 1 cut(s) 18
SetI ASST 3 cut(s) 61, 201, 252
SgeI CNNG 5 cut(s) 72, 87, 143, 188, 219
Sse9I AATT 3 cut(s) 48, 116, 165
TaaI ACNGT 1 cut(s) 238
TasI AATT 3 cut(s) 48, 116, 165
TatI WGTACW 1 cut(s) 16
Tru1I TTAA 2 cut(s) 9, 246
Tru9I TTAA 2 cut(s) 9, 246
TspDTI ATGAA 3 cut(s) 107, 117, 162
TspGWI ACGGA 1 cut(s) 38
XapI RAATTY 1 cut(s) 116
ZrmI AGTACT 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.