Rh5CG565800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
80071185 .. 80072297
1113 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG565800.1

Sequence Viewer

Length: 195 bp
ATGAAGGATGATGAAGATCCTTCCGAATTTCCATCTATTCCAGAGGAACCCCCTTATGAAAGTTTTACACCCATAATTGGGAGACCAGATGATCCTCATAAATCAAAGCTTAGATCATGCAAAGGAAAAGAAGTGAAGGCAAATACTGTTGCTATTAAGGATGATGAAGATGCGCCCCTTATCATGTCATTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.16

Weight (kDa)

4.56

Isoelectric Point (pI)

66.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 11, 86
AcsI RAATTY 1 cut(s) 26
AfiI CCNNNNNNNGG 2 cut(s) 77, 78
AluBI AGCT 1 cut(s) 109
AluI AGCT 1 cut(s) 109
Alw26I GTCTC 1 cut(s) 76
AlwI GGATC 2 cut(s) 11, 86
ApoI RAATTY 1 cut(s) 26
AspLEI GCGC 1 cut(s) 175
BccI CCATC 1 cut(s) 40
BcoDI GTCTC 1 cut(s) 76
BmiI GGNNCC 1 cut(s) 48
BmsI GCATC 1 cut(s) 160
BsaBI GATNNNNATC 1 cut(s) 15
BsaI GGTCTC 1 cut(s) 76
Bsc4I CCNNNNNNNGG 2 cut(s) 77, 78
Bse8I GATNNNNATC 1 cut(s) 15
BseGI GGATG 2 cut(s) 13, 166
BseJI GATNNNNATC 1 cut(s) 15
BseLI CCNNNNNNNGG 2 cut(s) 77, 78
BslI CCNNNNNNNGG 2 cut(s) 77, 78
BsmAI GTCTC 1 cut(s) 76
Bso31I GGTCTC 1 cut(s) 76
Bsp143I GATC 3 cut(s) 16, 91, 113
BspLI GGNNCC 1 cut(s) 48
BspPI GGATC 2 cut(s) 11, 86
BspTNI GGTCTC 1 cut(s) 76
BssMI GATC 3 cut(s) 16, 91, 113
Bst4CI ACNGT 1 cut(s) 148
BstDEI CTNAG 1 cut(s) 110
BstF5I GGATG 2 cut(s) 13, 166
BstHHI GCGC 1 cut(s) 175
BstKTI GATC 3 cut(s) 19, 94, 116
BstMAI GTCTC 1 cut(s) 76
BstMBI GATC 3 cut(s) 16, 91, 113
BstX2I RGATCY 1 cut(s) 16
BstYI RGATCY 1 cut(s) 16
BtsCI GGATG 2 cut(s) 13, 166
CfoI GCGC 1 cut(s) 175
CviAII CATG 2 cut(s) 117, 184
CviJI RGCY 1 cut(s) 109
CviKI_1 RGCY 1 cut(s) 109
DdeI CTNAG 1 cut(s) 110
DpnI GATC 3 cut(s) 18, 93, 115
DpnII GATC 3 cut(s) 16, 91, 113
Eco31I GGTCTC 1 cut(s) 76
FaeI CATG 2 cut(s) 120, 187
FaiI YATR 6 cut(s) 57, 74, 99, 118, 185, 193
FatI CATG 2 cut(s) 116, 183
FokI GGATG 2 cut(s) 20, 173
GlaI GCGC 1 cut(s) 174
HhaI GCGC 1 cut(s) 175
Hin1II CATG 2 cut(s) 120, 187
Hin6I GCGC 1 cut(s) 173
HinP1I GCGC 1 cut(s) 173
HindIII AAGCTT 1 cut(s) 107
Hpy188I TCNGA 1 cut(s) 25
Hpy188III TCNNGA 1 cut(s) 41
HpyAV CCTTC 2 cut(s) 30, 130
HpyCH4III ACNGT 1 cut(s) 148
HpyCH4V TGCA 1 cut(s) 120
HpyF3I CTNAG 1 cut(s) 110
Hsp92II CATG 2 cut(s) 120, 187
HspAI GCGC 1 cut(s) 173
Kzo9I GATC 3 cut(s) 16, 91, 113
LpnPI CCDG 2 cut(s) 54, 99
LweI GCATC 1 cut(s) 160
MalI GATC 3 cut(s) 18, 93, 115
MboI GATC 3 cut(s) 16, 91, 113
MboII GAAGA 2 cut(s) 26, 179
MflI RGATCY 1 cut(s) 16
MluCI AATT 2 cut(s) 26, 75
MnlI CCTC 2 cut(s) 37, 105
MseI TTAA 1 cut(s) 156
NdeII GATC 3 cut(s) 16, 91, 113
NlaIII CATG 2 cut(s) 120, 187
NlaIV GGNNCC 1 cut(s) 48
PspN4I GGNNCC 1 cut(s) 48
PsuI RGATCY 1 cut(s) 16
SaqAI TTAA 1 cut(s) 156
Sau3AI GATC 3 cut(s) 16, 91, 113
SetI ASST 1 cut(s) 111
SfaNI GCATC 1 cut(s) 160
SgeI CNNG 3 cut(s) 53, 98, 129
Sse9I AATT 2 cut(s) 26, 75
TaaI ACNGT 1 cut(s) 148
TasI AATT 2 cut(s) 26, 75
Tru1I TTAA 1 cut(s) 156
Tru9I TTAA 1 cut(s) 156
TspDTI ATGAA 4 cut(s) 17, 27, 72, 180
XapI RAATTY 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.