Rroxscaffold_1G00025700

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
32251652 .. 32252826
1175 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00025700.1

Sequence Viewer

Length: 288 bp
ATGGTAGAAATATCGGAAGTGCAAGACAAGTCTTCTTGCCACGTGGCTTCCGTACGACCATTACCCCCTAGTCCCCCACGGCCCCAACTAAGAAGAGTTTTGACCGGGGTGAAGAAACCTTGGTTCTTCTCGTGGTGGTCGAAGTGGTCTGGGCCTCCCGAGGAAAATGTGGGTCACGAGGATTCTAGTGCTGAAGAATATGAGTTACTAGAGATTCCCCAATCGCCGGGTGGCCGATTACTAGTGGCACCCGACGATATGCCCATTGACCAACCGGGCCGAGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

95

Amino Acids

10.67

Weight (kDa)

5.06

Isoelectric Point (pI)

85.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 247
AcoI YGGCCR 1 cut(s) 232
AcuI CTGAAG 1 cut(s) 213
AcvI CACGTG 1 cut(s) 43
AfaI GTAC 1 cut(s) 54
AfiI CCNNNNNNNGG 1 cut(s) 226
AhlI ACTAGT 1 cut(s) 241
Ama87I CYCGRG 1 cut(s) 158
AoxI GGCC 4 cut(s) 80, 152, 232, 277
AspS9I GGNCC 3 cut(s) 81, 152, 277
AsuC2I CCSGG 3 cut(s) 106, 228, 276
AsuHPI GGTGA 1 cut(s) 121
AvaI CYCGRG 1 cut(s) 158
BanI GGYRCC 1 cut(s) 247
BauI CACGAG 2 cut(s) 130, 176
BbrPI CACGTG 1 cut(s) 43
BbsI GAAGAC 1 cut(s) 24
BceAI ACGGC 1 cut(s) 95
BcnI CCSGG 3 cut(s) 106, 228, 276
BcuI ACTAGT 1 cut(s) 241
BfaI CTAG 4 cut(s) 69, 186, 209, 242
Bme1390I CCNGG 3 cut(s) 106, 228, 276
BmeT110I CYCGRG 1 cut(s) 158
BmgT120I GGNCC 3 cut(s) 81, 152, 277
BmiI GGNNCC 2 cut(s) 83, 249
BmrFI CCNGG 3 cut(s) 106, 228, 276
BpiI GAAGAC 1 cut(s) 24
BpuMI CCSGG 3 cut(s) 106, 228, 276
BsaAI YACGTR 1 cut(s) 43
BsaJI CCNNGG 4 cut(s) 77, 105, 119, 159
Bsc4I CCNNNNNNNGG 1 cut(s) 226
BseDI CCNNGG 4 cut(s) 77, 105, 119, 159
BseLI CCNNNNNNNGG 1 cut(s) 226
BshFI GGCC 4 cut(s) 82, 154, 234, 279
BshNI GGYRCC 1 cut(s) 247
BsiHKCI CYCGRG 1 cut(s) 158
BsiSI CCGG 3 cut(s) 105, 227, 275
BsiWI CGTACG 1 cut(s) 52
BslFI GGGAC 1 cut(s) 57
BslI CCNNNNNNNGG 1 cut(s) 226
BsmFI GGGAC 1 cut(s) 57
BsnI GGCC 4 cut(s) 82, 154, 234, 279
BsoBI CYCGRG 1 cut(s) 158
BspANI GGCC 4 cut(s) 82, 154, 234, 279
BspLI GGNNCC 2 cut(s) 83, 249
BspT107I GGYRCC 1 cut(s) 247
BssECI CCNNGG 4 cut(s) 77, 105, 119, 159
BssSI CACGAG 2 cut(s) 130, 176
BssT1I CCWWGG 1 cut(s) 119
Bst2BI CACGAG 2 cut(s) 130, 176
Bst6I CTCTTC 1 cut(s) 88
BstBAI YACGTR 1 cut(s) 43
BstDEI CTNAG 1 cut(s) 89
BstDSI CCRYGG 1 cut(s) 77
BstSCI CCNGG 3 cut(s) 104, 226, 274
BstV2I GAAGAC 1 cut(s) 24
BsuRI GGCC 4 cut(s) 82, 154, 234, 279
BtgI CCRYGG 1 cut(s) 77
Cfr13I GGNCC 3 cut(s) 81, 152, 277
Csp6I GTAC 1 cut(s) 53
CviJI RGCY 5 cut(s) 47, 82, 154, 234, 279
CviKI_1 RGCY 5 cut(s) 47, 82, 154, 234, 279
CviQI GTAC 1 cut(s) 53
DdeI CTNAG 1 cut(s) 89
EaeI YGGCCR 1 cut(s) 232
Eam1104I CTCTTC 1 cut(s) 88
EarI CTCTTC 1 cut(s) 88
Eco130I CCWWGG 1 cut(s) 119
Eco57I CTGAAG 1 cut(s) 213
Eco72I CACGTG 1 cut(s) 43
Eco88I CYCGRG 1 cut(s) 158
EcoT14I CCWWGG 1 cut(s) 119
ErhI CCWWGG 1 cut(s) 119
FaiI YATR 3 cut(s) 201, 260, 286
FaqI GGGAC 1 cut(s) 57
FspBI CTAG 4 cut(s) 69, 186, 209, 242
HaeIII GGCC 4 cut(s) 82, 154, 234, 279
HapII CCGG 3 cut(s) 105, 227, 275
HinfI GANTC 2 cut(s) 182, 214
HpaII CCGG 3 cut(s) 105, 227, 275
HphI GGTGA 1 cut(s) 121
Hpy188I TCNGA 1 cut(s) 16
Hpy188III TCNNGA 2 cut(s) 158, 176
Hpy99I CGWCG 1 cut(s) 257
HpyCH4IV ACGT 1 cut(s) 42
HpyCH4V TGCA 1 cut(s) 22
HpyF3I CTNAG 1 cut(s) 89
HpySE526I ACGT 1 cut(s) 42
LpnPI CCDG 3 cut(s) 118, 135, 240
MaeI CTAG 4 cut(s) 69, 186, 209, 242
MaeII ACGT 1 cut(s) 42
MaeIII GTNAC 2 cut(s) 173, 204
MboII GAAGA 5 cut(s) 24, 105, 118, 124, 206
MnlI CCTC 3 cut(s) 154, 165, 172
MspI CCGG 3 cut(s) 105, 227, 275
MspR9I CCNGG 3 cut(s) 106, 228, 276
NciI CCSGG 3 cut(s) 106, 228, 276
NlaIV GGNNCC 2 cut(s) 83, 249
NmuCI GTSAC 1 cut(s) 173
PcsI WCGNNNNNNNCGW 2 cut(s) 48, 137
PfeI GAWTC 2 cut(s) 182, 214
Pfl23II CGTACG 1 cut(s) 52
PmaCI CACGTG 1 cut(s) 43
PmlI CACGTG 1 cut(s) 43
Ppu21I YACGTR 1 cut(s) 43
PspCI CACGTG 1 cut(s) 43
PspLI CGTACG 1 cut(s) 52
PspN4I GGNNCC 2 cut(s) 83, 249
PspPI GGNCC 3 cut(s) 81, 152, 277
RsaI GTAC 1 cut(s) 54
RsaNI GTAC 1 cut(s) 53
Sau96I GGNCC 3 cut(s) 81, 152, 277
ScrFI CCNGG 3 cut(s) 106, 228, 276
SetI ASST 2 cut(s) 45, 121
SpeI ACTAGT 1 cut(s) 241
SspMI CTAG 4 cut(s) 69, 186, 209, 242
StyD4I CCNGG 3 cut(s) 104, 226, 274
StyI CCWWGG 1 cut(s) 119
TaiI ACGT 1 cut(s) 45
TaqI TCGA 1 cut(s) 140
TfiI GAWTC 2 cut(s) 182, 214
TseFI GTSAC 1 cut(s) 173
Tsp45I GTSAC 1 cut(s) 173
TspGWI ACGGA 1 cut(s) 40
XcmI CCANNNNNNNNNTGG 1 cut(s) 227
XspI CTAG 4 cut(s) 69, 186, 209, 242
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.