Rroxscaffold_1G00027300

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
34502064 .. 34504850
2787 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00027300.1

Sequence Viewer

Length: 195 bp
ATGGCTGTTCTTACGGTTCCGTTTACCATGGACTTTCCAAAGGAACCAAAGGTGGTTGATCTTGCTCGATTCCGACTAAAAGTGGGACCTGTATGTAAGGAGCAGAAAGCTAAACTGATCAAGATGGAGGCTGATATCCTCCTATCTCTGAAATTTGAAATGGGAAATCTCAATGTTGGTACATCCTTGAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.21

Weight (kDa)

9.58

Isoelectric Point (pI)

22.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 152
AfaI GTAC 1 cut(s) 181
AgsI TTSAA 1 cut(s) 158
AluBI AGCT 1 cut(s) 110
AluI AGCT 1 cut(s) 110
ApoI RAATTY 1 cut(s) 152
AspS9I GGNCC 1 cut(s) 86
AvaII GGWCC 1 cut(s) 86
BccI CCATC 1 cut(s) 118
BclI TGATCA 1 cut(s) 117
Bme18I GGWCC 1 cut(s) 86
BmgT120I GGNCC 1 cut(s) 86
BmiI GGNNCC 3 cut(s) 18, 45, 87
BsaJI CCNNGG 1 cut(s) 27
BseDI CCNNGG 1 cut(s) 27
BseGI GGATG 1 cut(s) 182
BslFI GGGAC 1 cut(s) 99
BsmFI GGGAC 1 cut(s) 99
Bsp143I GATC 2 cut(s) 58, 117
Bsp19I CCATGG 1 cut(s) 27
BspLI GGNNCC 3 cut(s) 18, 45, 87
BssECI CCNNGG 1 cut(s) 27
BssMI GATC 2 cut(s) 58, 117
BssT1I CCWWGG 1 cut(s) 27
Bst4CI ACNGT 1 cut(s) 16
BstDSI CCRYGG 1 cut(s) 27
BstF5I GGATG 1 cut(s) 182
BstKTI GATC 2 cut(s) 61, 120
BstMBI GATC 2 cut(s) 58, 117
BtgI CCRYGG 1 cut(s) 27
BtsCI GGATG 1 cut(s) 182
Cfr13I GGNCC 1 cut(s) 86
Csp6I GTAC 1 cut(s) 180
CviAII CATG 1 cut(s) 28
CviJI RGCY 3 cut(s) 5, 110, 131
CviKI_1 RGCY 3 cut(s) 5, 110, 131
CviQI GTAC 1 cut(s) 180
DpnI GATC 2 cut(s) 60, 119
DpnII GATC 2 cut(s) 58, 117
Eco130I CCWWGG 1 cut(s) 27
Eco32I GATATC 1 cut(s) 136
Eco47I GGWCC 1 cut(s) 86
EcoO109I RGGNCCY 1 cut(s) 86
EcoRV GATATC 1 cut(s) 136
EcoT14I CCWWGG 1 cut(s) 27
ErhI CCWWGG 1 cut(s) 27
FaeI CATG 1 cut(s) 31
FaiI YATR 2 cut(s) 29, 94
FaqI GGGAC 1 cut(s) 99
FatI CATG 1 cut(s) 27
FbaI TGATCA 1 cut(s) 117
FokI GGATG 1 cut(s) 169
Hin1II CATG 1 cut(s) 31
HinfI GANTC 1 cut(s) 69
Hpy166II GTNNAC 1 cut(s) 24
Hpy188I TCNGA 2 cut(s) 74, 150
Hpy188III TCNNGA 1 cut(s) 121
Hpy8I GTNNAC 1 cut(s) 24
HpyCH4III ACNGT 1 cut(s) 16
Hsp92II CATG 1 cut(s) 31
Ksp22I TGATCA 1 cut(s) 117
Kzo9I GATC 2 cut(s) 58, 117
LmnI GCTCC 1 cut(s) 100
LpnPI CCDG 1 cut(s) 102
MalI GATC 2 cut(s) 60, 119
MboI GATC 2 cut(s) 58, 117
MluCI AATT 1 cut(s) 152
MmeI TCCRAC 1 cut(s) 97
MnlI CCTC 3 cut(s) 121, 149, 183
NcoI CCATGG 1 cut(s) 27
NdeII GATC 2 cut(s) 58, 117
NlaIII CATG 1 cut(s) 31
NlaIV GGNNCC 3 cut(s) 18, 45, 87
PfeI GAWTC 1 cut(s) 69
PpuMI RGGWCCY 1 cut(s) 86
Psp5II RGGWCCY 1 cut(s) 86
PspN4I GGNNCC 3 cut(s) 18, 45, 87
PspPI GGNCC 1 cut(s) 86
PspPPI RGGWCCY 1 cut(s) 86
RsaI GTAC 1 cut(s) 181
RsaNI GTAC 1 cut(s) 180
Sau3AI GATC 2 cut(s) 58, 117
Sau96I GGNCC 1 cut(s) 86
SetI ASST 4 cut(s) 54, 91, 112, 194
SgeI CNNG 5 cut(s) 40, 74, 78, 101, 133
SinI GGWCC 1 cut(s) 86
SmlI CTYRAG 1 cut(s) 187
SmoI CTYRAG 1 cut(s) 187
Sse9I AATT 1 cut(s) 152
StyI CCWWGG 1 cut(s) 27
TaaI ACNGT 1 cut(s) 16
TaqI TCGA 1 cut(s) 67
TasI AATT 1 cut(s) 152
TfiI GAWTC 1 cut(s) 69
TspGWI ACGGA 1 cut(s) 9
VpaK11BI GGWCC 1 cut(s) 86
XapI RAATTY 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.