Rh1DG071800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Forward (+)
12943086 .. 12986245
43160 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG071800.1

Sequence Viewer

Length: 327 bp
ATGGAAAATTATGCACTCAACCGACGGGCGTTTAATGCTTGTTTGGAAATGGAACCTTCTTGGTTGGTTCAACATATTGACATGTCACAAGTTGTAATTGATATAGCTTATGTACCTTATGTGTGTTTCTTTCATGATGTATTCTGTATGAGCTTTCCTGTCCTTTTTAGAATATATGTGAATAAAGCCTTGCAATGTCAAGCTGATGGCTTTGAACTTAATGGCACCTCATGTTCTTTGAAACCAGAGTGGAGGCTGAGTTCCAAGGATACTAGTCCTTCCACGGGATCCTTAGCTTTGACCTGTTACATTGAAGGGGAAGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

108

Amino Acids

12.3

Weight (kDa)

4.77

Isoelectric Point (pI)

61.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 224
AclWI GGATC 2 cut(s) 282, 295
AfaI GTAC 1 cut(s) 114
AfiI CCNNNNNNNGG 1 cut(s) 284
AflIII ACRYGT 1 cut(s) 81
AgsI TTSAA 4 cut(s) 71, 215, 241, 314
AhlI ACTAGT 1 cut(s) 272
AloI GAACNNNNNNTCC 2 cut(s) 244, 276
AluBI AGCT 4 cut(s) 107, 153, 203, 296
AluI AGCT 4 cut(s) 107, 153, 203, 296
AlwI GGATC 2 cut(s) 282, 295
BamHI GGATCC 1 cut(s) 287
BanI GGYRCC 1 cut(s) 224
BccI CCATC 1 cut(s) 200
BciVI GTATCC 1 cut(s) 262
BcuI ACTAGT 1 cut(s) 272
BfaI CTAG 1 cut(s) 273
BfuI GTATCC 1 cut(s) 262
BmiI GGNNCC 3 cut(s) 54, 226, 289
Bpu10I CCTNAGC 1 cut(s) 292
BsaJI CCNNGG 2 cut(s) 264, 282
BsaXI ACNNNNNCTCC 2 cut(s) 244, 274
Bsc4I CCNNNNNNNGG 1 cut(s) 284
Bse3DI GCAATG 1 cut(s) 200
BseDI CCNNGG 2 cut(s) 264, 282
BseLI CCNNNNNNNGG 1 cut(s) 284
BseMI GCAATG 1 cut(s) 200
BseMII CTCAG 1 cut(s) 248
BshNI GGYRCC 1 cut(s) 224
BslI CCNNNNNNNGG 1 cut(s) 284
Bsp143I GATC 1 cut(s) 287
BspCNI CTCAG 1 cut(s) 249
BspHI TCATGA 1 cut(s) 133
BspLI GGNNCC 3 cut(s) 54, 226, 289
BspPI GGATC 2 cut(s) 282, 295
BspT107I GGYRCC 1 cut(s) 224
BsrDI GCAATG 1 cut(s) 200
BssECI CCNNGG 2 cut(s) 264, 282
BssMI GATC 1 cut(s) 287
BssT1I CCWWGG 1 cut(s) 264
BstDEI CTNAG 2 cut(s) 257, 292
BstDSI CCRYGG 1 cut(s) 282
BstKTI GATC 1 cut(s) 290
BstMBI GATC 1 cut(s) 287
BstMWI GCNNNNNNNGC 1 cut(s) 35
BstNSI RCATGY 1 cut(s) 85
BstX2I RGATCY 1 cut(s) 287
BstYI RGATCY 1 cut(s) 287
BsuI GTATCC 1 cut(s) 262
BtgI CCRYGG 1 cut(s) 282
CciI TCATGA 1 cut(s) 133
Csp6I GTAC 1 cut(s) 113
CviAII CATG 3 cut(s) 82, 134, 231
CviJI RGCY 7 cut(s) 107, 153, 188, 203, 210, 256, 296
CviKI_1 RGCY 7 cut(s) 107, 153, 188, 203, 210, 256, 296
CviQI GTAC 1 cut(s) 113
DdeI CTNAG 2 cut(s) 257, 292
DpnI GATC 1 cut(s) 289
DpnII GATC 1 cut(s) 287
Eco130I CCWWGG 1 cut(s) 264
EcoT14I CCWWGG 1 cut(s) 264
ErhI CCWWGG 1 cut(s) 264
FaeI CATG 3 cut(s) 85, 137, 234
FatI CATG 3 cut(s) 81, 133, 230
FspBI CTAG 1 cut(s) 273
Hin1II CATG 3 cut(s) 85, 137, 234
Hpy188III TCNNGA 1 cut(s) 134
Hpy99I CGWCG 1 cut(s) 27
HpyAV CCTTC 3 cut(s) 66, 288, 308
HpyCH4V TGCA 2 cut(s) 14, 193
HpyF10VI GCNNNNNNNGC 1 cut(s) 35
HpyF3I CTNAG 2 cut(s) 257, 292
Hsp92II CATG 3 cut(s) 85, 137, 234
Kzo9I GATC 1 cut(s) 287
LpnPI CCDG 3 cut(s) 171, 258, 316
MaeI CTAG 1 cut(s) 273
MaeIII GTNAC 2 cut(s) 84, 305
MalI GATC 1 cut(s) 289
MboI GATC 1 cut(s) 287
MflI RGATCY 1 cut(s) 287
MluCI AATT 2 cut(s) 7, 96
MnlI CCTC 2 cut(s) 238, 246
MseI TTAA 2 cut(s) 33, 219
MwoI GCNNNNNNNGC 1 cut(s) 35
NdeII GATC 1 cut(s) 287
NlaIII CATG 3 cut(s) 85, 137, 234
NlaIV GGNNCC 3 cut(s) 54, 226, 289
NmuCI GTSAC 1 cut(s) 84
NspI RCATGY 1 cut(s) 85
PagI TCATGA 1 cut(s) 133
PciI ACATGT 1 cut(s) 81
PscI ACATGT 1 cut(s) 81
PspN4I GGNNCC 3 cut(s) 54, 226, 289
PsuI RGATCY 1 cut(s) 287
RsaI GTAC 1 cut(s) 114
RsaNI GTAC 1 cut(s) 113
SaqAI TTAA 2 cut(s) 33, 219
Sau3AI GATC 1 cut(s) 287
SetI ASST 8 cut(s) 58, 109, 118, 155, 205, 230, 298, 305
SpeI ACTAGT 1 cut(s) 272
Sse9I AATT 2 cut(s) 7, 96
SspMI CTAG 1 cut(s) 273
StyI CCWWGG 1 cut(s) 264
TasI AATT 2 cut(s) 7, 96
Tru1I TTAA 2 cut(s) 33, 219
Tru9I TTAA 2 cut(s) 33, 219
TseFI GTSAC 1 cut(s) 84
Tsp45I GTSAC 1 cut(s) 84
TspDTI ATGAA 1 cut(s) 122
XceI RCATGY 1 cut(s) 85
XspI CTAG 1 cut(s) 273
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.