Rh1CG066900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0002754
Physical Location & Seq
Forward (+)
13748867 .. 13773504
24638 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG066900.1

Sequence Viewer

Length: 162 bp
ATGATGCAGGAGGCCTCTCCTGATACTAGTCCTTCCACGGGATCCTTAGCTTTGACCTGTTACATTGAAGGAATGAGTGATAATGGGAAGTGTAGGTTCACCATATGCCGATGGAAGCAATGGCTAGAGACTAAATTAAAATATTTTAAAAAAAGGCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

6.2

Weight (kDa)

9.22

Isoelectric Point (pI)

59.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 36, 49
AfiI CCNNNNNNNGG 1 cut(s) 38
AgsI TTSAA 1 cut(s) 68
AhlI ACTAGT 1 cut(s) 26
AluBI AGCT 1 cut(s) 50
AluI AGCT 1 cut(s) 50
Alw26I GTCTC 1 cut(s) 122
AlwI GGATC 2 cut(s) 36, 49
AoxI GGCC 1 cut(s) 12
AsuHPI GGTGA 1 cut(s) 91
BamHI GGATCC 1 cut(s) 41
BccI CCATC 1 cut(s) 105
BcoDI GTCTC 1 cut(s) 122
BcuI ACTAGT 1 cut(s) 26
BfaI CTAG 2 cut(s) 27, 125
BmiI GGNNCC 1 cut(s) 43
Bpu10I CCTNAGC 1 cut(s) 46
BsaJI CCNNGG 1 cut(s) 36
Bsc4I CCNNNNNNNGG 1 cut(s) 38
Bse3DI GCAATG 1 cut(s) 125
BseDI CCNNGG 1 cut(s) 36
BseLI CCNNNNNNNGG 1 cut(s) 38
BseMI GCAATG 1 cut(s) 125
BshFI GGCC 1 cut(s) 14
BslI CCNNNNNNNGG 1 cut(s) 38
BsmAI GTCTC 1 cut(s) 122
BsnI GGCC 1 cut(s) 14
Bsp143I GATC 1 cut(s) 41
BspANI GGCC 1 cut(s) 14
BspLI GGNNCC 1 cut(s) 43
BspPI GGATC 2 cut(s) 36, 49
BsrDI GCAATG 1 cut(s) 125
BssECI CCNNGG 1 cut(s) 36
BssMI GATC 1 cut(s) 41
BstDEI CTNAG 1 cut(s) 46
BstDSI CCRYGG 1 cut(s) 36
BstKTI GATC 1 cut(s) 44
BstMAI GTCTC 1 cut(s) 122
BstMBI GATC 1 cut(s) 41
BstX2I RGATCY 1 cut(s) 41
BstYI RGATCY 1 cut(s) 41
BsuRI GGCC 1 cut(s) 14
BtgI CCRYGG 1 cut(s) 36
CviJI RGCY 3 cut(s) 14, 50, 124
CviKI_1 RGCY 3 cut(s) 14, 50, 124
DdeI CTNAG 1 cut(s) 46
DpnI GATC 1 cut(s) 43
DpnII GATC 1 cut(s) 41
DraI TTTAAA 1 cut(s) 148
Eco147I AGGCCT 1 cut(s) 14
FaiI YATR 2 cut(s) 104, 106
FauNDI CATATG 1 cut(s) 104
FspBI CTAG 2 cut(s) 27, 125
HaeIII GGCC 1 cut(s) 14
HphI GGTGA 1 cut(s) 91
Hpy166II GTNNAC 1 cut(s) 99
Hpy188III TCNNGA 1 cut(s) 20
Hpy8I GTNNAC 1 cut(s) 99
HpyAV CCTTC 2 cut(s) 42, 62
HpyCH4V TGCA 1 cut(s) 7
HpyF3I CTNAG 1 cut(s) 46
Kzo9I GATC 1 cut(s) 41
LpnPI CCDG 2 cut(s) 33, 70
MaeI CTAG 2 cut(s) 27, 125
MaeIII GTNAC 1 cut(s) 59
MalI GATC 1 cut(s) 43
MboI GATC 1 cut(s) 41
MflI RGATCY 1 cut(s) 41
MluCI AATT 1 cut(s) 134
MnlI CCTC 2 cut(s) 4, 25
MseI TTAA 2 cut(s) 137, 147
NdeI CATATG 1 cut(s) 104
NdeII GATC 1 cut(s) 41
NlaIV GGNNCC 1 cut(s) 43
PceI AGGCCT 1 cut(s) 14
PspN4I GGNNCC 1 cut(s) 43
PsuI RGATCY 1 cut(s) 41
SaqAI TTAA 2 cut(s) 137, 147
Sau3AI GATC 1 cut(s) 41
SetI ASST 3 cut(s) 52, 59, 98
SgeI CNNG 7 cut(s) 20, 32, 39, 49, 51, 69, 137
SpeI ACTAGT 1 cut(s) 26
Sse9I AATT 1 cut(s) 134
SseBI AGGCCT 1 cut(s) 14
SspI AATATT 1 cut(s) 143
SspMI CTAG 2 cut(s) 27, 125
StuI AGGCCT 1 cut(s) 14
TasI AATT 1 cut(s) 134
Tru1I TTAA 2 cut(s) 137, 147
Tru9I TTAA 2 cut(s) 137, 147
XspI CTAG 2 cut(s) 27, 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.