Rh2CG280100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
31120773 .. 31122808
2036 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG280100.1

Sequence Viewer

Length: 186 bp
ATGGCTGTTCTTACAGTTCCATTTACCATGGGCTTTCCAAAGGCAATTTTAAAGATTGCAGTACTTGATACTAGTCCTTCCACGGGATCCTTAGCTTTGAGCTGTTACATTGAAGGAATGAGTGATAATGGGAAGTGTAGGTTCACCATATGCCGATGGAAGCAATGGCTAGAGACTAAATTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.77

Weight (kDa)

8.99

Isoelectric Point (pI)

58.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 81, 94
AfaI GTAC 1 cut(s) 63
AfiI CCNNNNNNNGG 1 cut(s) 83
AgsI TTSAA 1 cut(s) 113
AhlI ACTAGT 1 cut(s) 71
AluBI AGCT 2 cut(s) 95, 102
AluI AGCT 2 cut(s) 95, 102
Alw26I GTCTC 1 cut(s) 167
AlwI GGATC 2 cut(s) 81, 94
AsuHPI GGTGA 1 cut(s) 136
BamHI GGATCC 1 cut(s) 86
BccI CCATC 1 cut(s) 150
BcoDI GTCTC 1 cut(s) 167
BcuI ACTAGT 1 cut(s) 71
BfaI CTAG 2 cut(s) 72, 170
BmcAI AGTACT 1 cut(s) 63
BmiI GGNNCC 1 cut(s) 88
Bpu10I CCTNAGC 1 cut(s) 91
BsaJI CCNNGG 2 cut(s) 27, 81
Bsc4I CCNNNNNNNGG 1 cut(s) 83
Bse3DI GCAATG 1 cut(s) 170
BseDI CCNNGG 2 cut(s) 27, 81
BseLI CCNNNNNNNGG 1 cut(s) 83
BseMI GCAATG 1 cut(s) 170
BslI CCNNNNNNNGG 1 cut(s) 83
BsmAI GTCTC 1 cut(s) 167
Bsp143I GATC 1 cut(s) 86
Bsp19I CCATGG 1 cut(s) 27
BspLI GGNNCC 1 cut(s) 88
BspPI GGATC 2 cut(s) 81, 94
BsrDI GCAATG 1 cut(s) 170
BssECI CCNNGG 2 cut(s) 27, 81
BssMI GATC 1 cut(s) 86
BssT1I CCWWGG 1 cut(s) 27
Bst4CI ACNGT 1 cut(s) 16
BstDEI CTNAG 1 cut(s) 91
BstDSI CCRYGG 2 cut(s) 27, 81
BstKTI GATC 1 cut(s) 89
BstMAI GTCTC 1 cut(s) 167
BstMBI GATC 1 cut(s) 86
BstX2I RGATCY 1 cut(s) 86
BstYI RGATCY 1 cut(s) 86
BtgI CCRYGG 2 cut(s) 27, 81
Csp6I GTAC 1 cut(s) 62
CviAII CATG 1 cut(s) 28
CviJI RGCY 5 cut(s) 5, 33, 95, 102, 169
CviKI_1 RGCY 5 cut(s) 5, 33, 95, 102, 169
CviQI GTAC 1 cut(s) 62
DdeI CTNAG 1 cut(s) 91
DpnI GATC 1 cut(s) 88
DpnII GATC 1 cut(s) 86
DraI TTTAAA 1 cut(s) 51
Eco130I CCWWGG 1 cut(s) 27
EcoT14I CCWWGG 1 cut(s) 27
ErhI CCWWGG 1 cut(s) 27
FaeI CATG 1 cut(s) 31
FaiI YATR 3 cut(s) 29, 149, 151
FatI CATG 1 cut(s) 27
FauNDI CATATG 1 cut(s) 149
FspBI CTAG 2 cut(s) 72, 170
Hin1II CATG 1 cut(s) 31
HphI GGTGA 1 cut(s) 136
Hpy166II GTNNAC 1 cut(s) 144
Hpy8I GTNNAC 1 cut(s) 144
HpyAV CCTTC 2 cut(s) 87, 107
HpyCH4III ACNGT 1 cut(s) 16
HpyCH4V TGCA 1 cut(s) 59
HpyF3I CTNAG 1 cut(s) 91
Hsp92II CATG 1 cut(s) 31
Kzo9I GATC 1 cut(s) 86
MaeI CTAG 2 cut(s) 72, 170
MaeIII GTNAC 1 cut(s) 104
MalI GATC 1 cut(s) 88
MboI GATC 1 cut(s) 86
MflI RGATCY 1 cut(s) 86
MluCI AATT 2 cut(s) 45, 179
MseI TTAA 1 cut(s) 50
NcoI CCATGG 1 cut(s) 27
NdeI CATATG 1 cut(s) 149
NdeII GATC 1 cut(s) 86
NlaIII CATG 1 cut(s) 31
NlaIV GGNNCC 1 cut(s) 88
PspN4I GGNNCC 1 cut(s) 88
PsuI RGATCY 1 cut(s) 86
RsaI GTAC 1 cut(s) 63
RsaNI GTAC 1 cut(s) 62
SaqAI TTAA 1 cut(s) 50
Sau3AI GATC 1 cut(s) 86
ScaI AGTACT 1 cut(s) 63
SetI ASST 3 cut(s) 97, 104, 143
SgeI CNNG 6 cut(s) 40, 77, 84, 94, 96, 182
SpeI ACTAGT 1 cut(s) 71
Sse9I AATT 2 cut(s) 45, 179
SspMI CTAG 2 cut(s) 72, 170
StyI CCWWGG 1 cut(s) 27
TaaI ACNGT 1 cut(s) 16
TasI AATT 2 cut(s) 45, 179
TatI WGTACW 1 cut(s) 61
Tru1I TTAA 1 cut(s) 50
Tru9I TTAA 1 cut(s) 50
XspI CTAG 2 cut(s) 72, 170
ZrmI AGTACT 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.