Rroxscaffold_2G00138100

Alpha,alpha-trehalose-phosphate synthase (UDP-forming)

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
76148718 .. 76156724
8007 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00138100.1

Sequence Viewer

Length: 168 bp
ATGGAGGTTTTTACGTCGAACGGAGTTTCGCCGTTTTCGGAAAAAATACGGCCAAAACCGTGGCTTCTAGATGTAGTACTTGAAACATCCCTCAGGGACGGAATGAATCTTGTCAGTTATGAATATGTAGCATTGCCAAGATGCAAAGAAAGGGGTCCTTATCCTTAG

Protein Analysis

55

Amino Acids

6.32

Weight (kDa)

6.13

Isoelectric Point (pI)

29.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_transf_20 PF00982 24 - 47 6.5e-06 Glycosyltransferase family 20
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 50
AfaI GTAC 1 cut(s) 78
AgsI TTSAA 1 cut(s) 83
AoxI GGCC 1 cut(s) 50
AspS9I GGNCC 1 cut(s) 155
AvaII GGWCC 1 cut(s) 155
AxyI CCTNAGG 1 cut(s) 92
BceAI ACGGC 2 cut(s) 16, 65
BfaI CTAG 1 cut(s) 68
BmcAI AGTACT 1 cut(s) 78
Bme18I GGWCC 1 cut(s) 155
BmgT120I GGNCC 1 cut(s) 155
BmiI GGNNCC 1 cut(s) 156
BmsI GCATC 1 cut(s) 131
BsaJI CCNNGG 1 cut(s) 59
Bse21I CCTNAGG 1 cut(s) 92
Bse3DI GCAATG 1 cut(s) 131
BseDI CCNNGG 1 cut(s) 59
BseGI GGATG 1 cut(s) 86
BseMI GCAATG 1 cut(s) 131
BseMII CTCAG 1 cut(s) 106
BshFI GGCC 1 cut(s) 52
BslFI GGGAC 1 cut(s) 110
BsmFI GGGAC 1 cut(s) 110
BsnI GGCC 1 cut(s) 52
BspANI GGCC 1 cut(s) 52
BspCNI CTCAG 1 cut(s) 105
BspLI GGNNCC 1 cut(s) 156
BsrDI GCAATG 1 cut(s) 131
BssECI CCNNGG 1 cut(s) 59
Bst4CI ACNGT 1 cut(s) 60
BstDEI CTNAG 2 cut(s) 92, 165
BstDSI CCRYGG 1 cut(s) 59
BstF5I GGATG 1 cut(s) 86
BstXI CCANNNNNNTGG 1 cut(s) 60
Bsu36I CCTNAGG 1 cut(s) 92
BsuRI GGCC 1 cut(s) 52
BtgI CCRYGG 1 cut(s) 59
BtsCI GGATG 1 cut(s) 86
Cfr13I GGNCC 1 cut(s) 155
Csp6I GTAC 1 cut(s) 77
CviJI RGCY 2 cut(s) 52, 64
CviKI_1 RGCY 2 cut(s) 52, 64
CviQI GTAC 1 cut(s) 77
DdeI CTNAG 2 cut(s) 92, 165
EaeI YGGCCR 1 cut(s) 50
Eco47I GGWCC 1 cut(s) 155
Eco81I CCTNAGG 1 cut(s) 92
EcoO109I RGGNCCY 1 cut(s) 155
FaiI YATR 2 cut(s) 120, 126
FalI AAGNNNNNCTT 1 cut(s) 142
FaqI GGGAC 1 cut(s) 110
FokI GGATG 1 cut(s) 73
FspBI CTAG 1 cut(s) 68
HaeIII GGCC 1 cut(s) 52
HinfI GANTC 1 cut(s) 106
Hpy188I TCNGA 1 cut(s) 40
Hpy188III TCNNGA 1 cut(s) 68
Hpy99I CGWCG 1 cut(s) 19
HpyCH4III ACNGT 1 cut(s) 60
HpyCH4IV ACGT 1 cut(s) 14
HpyCH4V TGCA 1 cut(s) 144
HpyF3I CTNAG 2 cut(s) 92, 165
HpySE526I ACGT 1 cut(s) 14
LpnPI CCDG 1 cut(s) 79
LweI GCATC 1 cut(s) 131
MaeI CTAG 1 cut(s) 68
MaeII ACGT 1 cut(s) 14
MnlI CCTC 1 cut(s) 101
NlaIV GGNNCC 1 cut(s) 156
PfeI GAWTC 1 cut(s) 106
PpuMI RGGWCCY 1 cut(s) 155
Psp5II RGGWCCY 1 cut(s) 155
PspN4I GGNNCC 1 cut(s) 156
PspPI GGNCC 1 cut(s) 155
PspPPI RGGWCCY 1 cut(s) 155
RsaI GTAC 1 cut(s) 78
RsaNI GTAC 1 cut(s) 77
Sau96I GGNCC 1 cut(s) 155
ScaI AGTACT 1 cut(s) 78
SetI ASST 2 cut(s) 9, 17
SfaNI GCATC 1 cut(s) 131
SgeI CNNG 6 cut(s) 72, 80, 92, 106, 122, 150
SinI GGWCC 1 cut(s) 155
SspMI CTAG 1 cut(s) 68
TaaI ACNGT 1 cut(s) 60
TaiI ACGT 1 cut(s) 17
TaqI TCGA 1 cut(s) 17
TatI WGTACW 1 cut(s) 76
TfiI GAWTC 1 cut(s) 106
TspDTI ATGAA 2 cut(s) 119, 135
TspGWI ACGGA 2 cut(s) 36, 114
VpaK11BI GGWCC 1 cut(s) 155
XbaI TCTAGA 1 cut(s) 67
XspI CTAG 1 cut(s) 68
ZrmI AGTACT 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.