Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000003

Orthogroup ID

OG0013728

Physical Location & Seq

Genomic Coordinates Forward (+)

40099124 .. 40104606

Gene Structure 5483 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_3G00246800.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 396 bp

ATGGACCACTTCTTCGACGAACTCGCCGCTAAGTCTGTCTCCCTCTCCAATCTGGTCCGCCCCATCGCCACCGCCACGGATTCTGGCCCGGCCCATTTCACCCTCTCCCATGGCGTTTTTCTCTCTTTGATCATAATACCCTCCGCTCTCCGCCTATCCCAATTACGAAATATGCCGCTGATCAATATGCTCCTCCAGACCCGGCCCTCAAAAAGGACTTTCGAAGAAGAATCAAAGATGTTCAAGGTGGTGCTGAACGATTGTCTTGGGAAGAAGTTGAAGGTGAAGGACAACGAGAACGACATCATCAACTTCCTGGAAGCTAAAGGTGTTTCTTTCTTTCCCCAATTTCGGTATCCGATCACTTTCTGGGCTCCATTACAGAATGCTTTTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cnd1

Protein Analysis

131

Amino Acids

14.89

Weight (kDa)

9.21

Isoelectric Point (pI)

41.56

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013728)

Species	Orthologous Gene IDs
malus_domestica	MD13G1128100.v1.1
rosa_chinensis	RchiOBHm_Chr4g0400321
rosa_laevigata	RLG00000019087 RLG00000019851 RLG00000029817 RLG00000036223
rosa_multiflora	Rmu_co8364043.1_g000001 Rmu_sc0000446.1_g000020 Rmu_sc0006567.1_g000017 Rmu_ssc0000245.1_g000016 Rmu_ssc0000245.1_g000028
rosa_roxburghii	Rroxscaffold_3G00246800 Rroxscaffold_3G00250210
rosa_rugosa	Rorug04G0024800
rosa_samantha	Rh2DG376000 Rh5DG042900 Rh6BG179100 Rh6DG076300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	146
AciI	CCGC	6 cut(s)	27, 58, 72, 144, 151, 176
AfiI	CCNNNNNNNGG	2 cut(s)	213, 351
AgsI	TTSAA	2 cut(s)	244, 280
AjnI	CCWGG	1 cut(s)	315
AluBI	AGCT	1 cut(s)	323
AluI	AGCT	1 cut(s)	323
Alw26I	GTCTC	1 cut(s)	43
AoxI	GGCC	3 cut(s)	85, 90, 203
ArsI	GACNNNNNNTTYG	1 cut(s)	28
AspS9I	GGNCC	5 cut(s)	4, 55, 86, 91, 204
AsuC2I	CCSGG	2 cut(s)	89, 202
AsuHPI	GGTGA	2 cut(s)	91, 295
AsuII	TTCGAA	1 cut(s)	222
AvaII	GGWCC	2 cut(s)	4, 55
BanII	GRGCYC	1 cut(s)	376
BccI	CCATC	1 cut(s)	71
BciT130I	CCWGG	1 cut(s)	317
BciVI	GTATCC	1 cut(s)	366
BclI	TGATCA	2 cut(s)	129, 180
BcnI	CCSGG	2 cut(s)	89, 202
BcoDI	GTCTC	1 cut(s)	43
BfuI	GTATCC	1 cut(s)	366
BisI	GCNGC	2 cut(s)	27, 176
BlsI	GCNGC	2 cut(s)	28, 177
Bme1390I	CCNGG	3 cut(s)	89, 202, 317
Bme18I	GGWCC	2 cut(s)	4, 55
BmgT120I	GGNCC	5 cut(s)	4, 55, 86, 91, 204
BmiI	GGNNCC	1 cut(s)	375
BmrFI	CCNGG	3 cut(s)	89, 202, 317
BpmI	CTGGAG	1 cut(s)	179
Bpu14I	TTCGAA	1 cut(s)	222
BpuMI	CCSGG	2 cut(s)	89, 202
BsaJI	CCNNGG	2 cut(s)	75, 109
Bsc4I	CCNNNNNNNGG	2 cut(s)	213, 351
BseBI	CCWGG	1 cut(s)	317
BseDI	CCNNGG	2 cut(s)	75, 109
BseLI	CCNNNNNNNGG	2 cut(s)	213, 351
BseRI	GAGGAG	1 cut(s)	182
BshFI	GGCC	3 cut(s)	87, 92, 205
BsiSI	CCGG	2 cut(s)	89, 202
BslI	CCNNNNNNNGG	2 cut(s)	213, 351
BsmAI	GTCTC	1 cut(s)	43
BsmI	GAATGC	1 cut(s)	391
BsnI	GGCC	3 cut(s)	87, 92, 205
Bsp119I	TTCGAA	1 cut(s)	222
Bsp1286I	GDGCHC	1 cut(s)	376
Bsp143I	GATC	3 cut(s)	129, 180, 360
Bsp19I	CCATGG	1 cut(s)	109
BspACI	CCGC	6 cut(s)	27, 58, 72, 144, 151, 176
BspANI	GGCC	3 cut(s)	87, 92, 205
BspLI	GGNNCC	1 cut(s)	375
BspT104I	TTCGAA	1 cut(s)	222
BsrBI	CCGCTC	1 cut(s)	146
BssECI	CCNNGG	2 cut(s)	75, 109
BssMI	GATC	3 cut(s)	129, 180, 360
BssT1I	CCWWGG	1 cut(s)	109
Bst2UI	CCWGG	1 cut(s)	317
BstBI	TTCGAA	1 cut(s)	222
BstDEI	CTNAG	1 cut(s)	30
BstDSI	CCRYGG	2 cut(s)	75, 109
BstENI	CCTNNNNNAGG	1 cut(s)	211
BstKTI	GATC	3 cut(s)	132, 183, 363
BstMAI	GTCTC	1 cut(s)	43
BstMBI	GATC	3 cut(s)	129, 180, 360
BstNI	CCWGG	1 cut(s)	317
BstSCI	CCNGG	3 cut(s)	87, 200, 315
BsuI	GTATCC	1 cut(s)	366
BsuRI	GGCC	3 cut(s)	87, 92, 205
BtgI	CCRYGG	2 cut(s)	75, 109
BtgZI	GCGATG	1 cut(s)	49
Cfr13I	GGNCC	5 cut(s)	4, 55, 86, 91, 204
CviAII	CATG	1 cut(s)	110
CviJI	RGCY	5 cut(s)	87, 92, 205, 323, 374
CviKI_1	RGCY	5 cut(s)	87, 92, 205, 323, 374
DdeI	CTNAG	1 cut(s)	30
DpnI	GATC	3 cut(s)	131, 182, 362
DpnII	GATC	3 cut(s)	129, 180, 360
EciI	GGCGGA	2 cut(s)	47, 140
Eco130I	CCWWGG	1 cut(s)	109
Eco24I	GRGCYC	1 cut(s)	376
Eco47I	GGWCC	2 cut(s)	4, 55
EcoNI	CCTNNNNNAGG	1 cut(s)	211
EcoRII	CCWGG	1 cut(s)	315
EcoT14I	CCWWGG	1 cut(s)	109
EcoT38I	GRGCYC	1 cut(s)	376
ErhI	CCWWGG	1 cut(s)	109
FaeI	CATG	1 cut(s)	113
FaiI	YATR	4 cut(s)	111, 134, 173, 188
FatI	CATG	1 cut(s)	109
FbaI	TGATCA	2 cut(s)	129, 180
Fnu4HI	GCNGC	2 cut(s)	27, 176
FriOI	GRGCYC	1 cut(s)	376
Fsp4HI	GCNGC	2 cut(s)	27, 176
GluI	GCNGC	2 cut(s)	27, 176
GsuI	CTGGAG	1 cut(s)	179
HaeIII	GGCC	3 cut(s)	87, 92, 205
HapII	CCGG	2 cut(s)	89, 202
Hin1II	CATG	1 cut(s)	113
HinfI	GANTC	2 cut(s)	80, 230
HpaII	CCGG	2 cut(s)	89, 202
HphI	GGTGA	2 cut(s)	91, 295
Hpy188I	TCNGA	1 cut(s)	360
Hpy188III	TCNNGA	1 cut(s)	196
Hpy99I	CGWCG	1 cut(s)	20
HpyAV	CCTTC	2 cut(s)	274, 280
HpyF3I	CTNAG	1 cut(s)	30
Hsp92II	CATG	1 cut(s)	113
Ksp22I	TGATCA	2 cut(s)	129, 180
Kzo9I	GATC	3 cut(s)	129, 180, 360
LmnI	GCTCC	2 cut(s)	195, 379
LpnPI	CCDG	8 cut(s)	38, 69, 102, 209, 215, 302, 329, 355
MalI	GATC	3 cut(s)	131, 182, 362
MbiI	CCGCTC	1 cut(s)	146
MboI	GATC	3 cut(s)	129, 180, 360
MboII	GAAGA	4 cut(s)	4, 236, 239, 283
MhlI	GDGCHC	1 cut(s)	376
MluCI	AATT	2 cut(s)	161, 347
MnlI	CCTC	5 cut(s)	53, 113, 151, 203, 217
MspA1I	CMGCKG	1 cut(s)	178
MspI	CCGG	2 cut(s)	89, 202
MspR9I	CCNGG	3 cut(s)	89, 202, 317
Mva1269I	GAATGC	1 cut(s)	391
MvaI	CCWGG	1 cut(s)	317
NciI	CCSGG	2 cut(s)	89, 202
NcoI	CCATGG	1 cut(s)	109
NdeII	GATC	3 cut(s)	129, 180, 360
NlaIII	CATG	1 cut(s)	113
NlaIV	GGNNCC	1 cut(s)	375
NspV	TTCGAA	1 cut(s)	222
PctI	GAATGC	1 cut(s)	391
PfeI	GAWTC	2 cut(s)	80, 230
PfoI	TCCNGGA	1 cut(s)	315
PkrI	GCNGC	2 cut(s)	28, 177
Psp6I	CCWGG	1 cut(s)	315
PspGI	CCWGG	1 cut(s)	315
PspN4I	GGNNCC	1 cut(s)	375
PspPI	GGNCC	5 cut(s)	4, 55, 86, 91, 204
SatI	GCNGC	2 cut(s)	27, 176
Sau3AI	GATC	3 cut(s)	129, 180, 360
Sau96I	GGNCC	5 cut(s)	4, 55, 86, 91, 204
ScrFI	CCNGG	3 cut(s)	89, 202, 317
SduI	GDGCHC	1 cut(s)	376
SetI	ASST	4 cut(s)	249, 285, 325, 331
SfuI	TTCGAA	1 cut(s)	222
SinI	GGWCC	2 cut(s)	4, 55
Sse9I	AATT	2 cut(s)	161, 347
SsiI	CCGC	6 cut(s)	27, 58, 72, 144, 151, 176
StyD4I	CCNGG	3 cut(s)	87, 200, 315
StyI	CCWWGG	1 cut(s)	109
TaqI	TCGA	2 cut(s)	15, 222
TasI	AATT	2 cut(s)	161, 347
TauI	GCSGC	2 cut(s)	29, 178
TfiI	GAWTC	2 cut(s)	80, 230
TspGWI	ACGGA	1 cut(s)	92
VpaK11BI	GGWCC	2 cut(s)	4, 55
XagI	CCTNNNNNAGG	1 cut(s)	211

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.