Rh6DG076300

Condensin-2 complex subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Forward (+)
8695842 .. 8696066
225 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG076300.1

Sequence Viewer

Length: 225 bp
ATGGAAGAAACCATAGCCCGAATAGTCACAGAGCTCGAAGACCTCCGCCACCTCGAAAACCCCACCAATACCCAATCCCAACCCATCTCTGATTCCACTCTCTCTGACCTCCAAACCCTCTTCGCCGCCAATTCCCTCTCCCTCTCCCTCTCCAATCTGGTCCGCCCCATCGCCACCGCCATGGATTCCGGCCCGACCCATTTCACCCTCTCCCATGGCTACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.1

Weight (kDa)

4.58

Isoelectric Point (pI)

37.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 46, 126, 163, 177
AluBI AGCT 1 cut(s) 34
AluI AGCT 1 cut(s) 34
Alw21I GWGCWC 1 cut(s) 36
AoxI GGCC 1 cut(s) 190
AspS9I GGNCC 2 cut(s) 160, 191
AsuHPI GGTGA 1 cut(s) 196
AvaII GGWCC 1 cut(s) 160
BanII GRGCYC 1 cut(s) 36
BbsI GAAGAC 1 cut(s) 45
Bbv12I GWGCWC 1 cut(s) 36
BccI CCATC 2 cut(s) 92, 176
BisI GCNGC 1 cut(s) 126
BlsI GCNGC 1 cut(s) 127
Bme18I GGWCC 1 cut(s) 160
BmgT120I GGNCC 2 cut(s) 160, 191
BpiI GAAGAC 1 cut(s) 45
BsaJI CCNNGG 2 cut(s) 180, 214
BseDI CCNNGG 2 cut(s) 180, 214
BshFI GGCC 1 cut(s) 192
BsiHKAI GWGCWC 1 cut(s) 36
BsiSI CCGG 1 cut(s) 189
BsnI GGCC 1 cut(s) 192
Bsp1286I GDGCHC 1 cut(s) 36
Bsp19I CCATGG 2 cut(s) 180, 214
BspACI CCGC 4 cut(s) 46, 126, 163, 177
BspANI GGCC 1 cut(s) 192
BssECI CCNNGG 2 cut(s) 180, 214
BssT1I CCWWGG 2 cut(s) 180, 214
Bst6I CTCTTC 1 cut(s) 125
BstDSI CCRYGG 2 cut(s) 180, 214
BstV2I GAAGAC 1 cut(s) 45
BstXI CCANNNNNNTGG 1 cut(s) 181
BsuRI GGCC 1 cut(s) 192
BtgI CCRYGG 2 cut(s) 180, 214
BtgZI GCGATG 1 cut(s) 154
Cfr13I GGNCC 2 cut(s) 160, 191
CviAII CATG 2 cut(s) 181, 215
CviJI RGCY 4 cut(s) 17, 34, 192, 219
CviKI_1 RGCY 4 cut(s) 17, 34, 192, 219
Eam1104I CTCTTC 1 cut(s) 125
EarI CTCTTC 1 cut(s) 125
EciI GGCGGA 2 cut(s) 35, 152
Ecl136II GAGCTC 1 cut(s) 34
Eco130I CCWWGG 2 cut(s) 180, 214
Eco24I GRGCYC 1 cut(s) 36
Eco47I GGWCC 1 cut(s) 160
Eco53kI GAGCTC 1 cut(s) 34
EcoICRI GAGCTC 1 cut(s) 34
EcoT14I CCWWGG 2 cut(s) 180, 214
EcoT38I GRGCYC 1 cut(s) 36
ErhI CCWWGG 2 cut(s) 180, 214
FaeI CATG 2 cut(s) 184, 218
FaiI YATR 3 cut(s) 14, 182, 216
FatI CATG 2 cut(s) 180, 214
Fnu4HI GCNGC 1 cut(s) 126
FriOI GRGCYC 1 cut(s) 36
Fsp4HI GCNGC 1 cut(s) 126
GluI GCNGC 1 cut(s) 126
HaeIII GGCC 1 cut(s) 192
HapII CCGG 1 cut(s) 189
Hin1II CATG 2 cut(s) 184, 218
HinfI GANTC 2 cut(s) 92, 185
HpaII CCGG 1 cut(s) 189
HphI GGTGA 1 cut(s) 196
Hpy188I TCNGA 2 cut(s) 91, 106
Hsp92II CATG 2 cut(s) 184, 218
LpnPI CCDG 2 cut(s) 143, 202
MaeIII GTNAC 1 cut(s) 25
MboII GAAGA 3 cut(s) 17, 50, 112
MhlI GDGCHC 1 cut(s) 36
MluCI AATT 1 cut(s) 130
MnlI CCTC 8 cut(s) 53, 62, 119, 128, 146, 152, 158, 218
MslI CAYNNNNRTG 1 cut(s) 179
MspI CCGG 1 cut(s) 189
NcoI CCATGG 2 cut(s) 180, 214
NlaIII CATG 2 cut(s) 184, 218
NmuCI GTSAC 1 cut(s) 25
PfeI GAWTC 2 cut(s) 92, 185
PkrI GCNGC 1 cut(s) 127
Psp124BI GAGCTC 1 cut(s) 36
PspPI GGNCC 2 cut(s) 160, 191
RseI CAYNNNNRTG 1 cut(s) 179
SacI GAGCTC 1 cut(s) 36
SatI GCNGC 1 cut(s) 126
Sau96I GGNCC 2 cut(s) 160, 191
SduI GDGCHC 1 cut(s) 36
SetI ASST 4 cut(s) 36, 45, 54, 111
SgeI CNNG 7 cut(s) 30, 47, 65, 170, 193, 201, 205
SinI GGWCC 1 cut(s) 160
SmiMI CAYNNNNRTG 1 cut(s) 179
Sse9I AATT 1 cut(s) 130
SsiI CCGC 4 cut(s) 46, 126, 163, 177
SstI GAGCTC 1 cut(s) 36
StyI CCWWGG 2 cut(s) 180, 214
TaqI TCGA 2 cut(s) 36, 54
TasI AATT 1 cut(s) 130
TauI GCSGC 1 cut(s) 128
TfiI GAWTC 2 cut(s) 92, 185
TseFI GTSAC 1 cut(s) 25
Tsp45I GTSAC 1 cut(s) 25
VpaK11BI GGWCC 1 cut(s) 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.