Rroxscaffold_4G00302570

RNA polymerase II subunit 5-mediating protein homolog

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
22933364 .. 22933630
267 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00302570.1

Sequence Viewer

Length: 267 bp
ATGTTGCTCCAATTCAAATTAAAAGTGGGATCAATTGTTTCAGTTGCACCCAAGCAAGATTATCCTAATAATTCTAGAGCTGTAATTGCAAAACCTGCTGATGAAGATGAAGAATTTGCTCGTATGATGGCCAGGATGGATGAACTTGAGAAAGAAGAACGTGAAGCTGAAAGTCAGATGGCACAAAGTGATGAGGATGAGCAACTTCAGCATGGTTTGCATCAGCTTTCTGATCAGAAATCTCTCCATGGGAATCTCAAAATTTAG

Protein Analysis

88

Amino Acids

10.05

Weight (kDa)

4.84

Isoelectric Point (pI)

41.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 103
AclWI GGATC 1 cut(s) 37
AcoI YGGCCR 1 cut(s) 129
AcsI RAATTY 2 cut(s) 113, 261
AcuI CTGAAG 1 cut(s) 191
AdeI CACNNNGTG 1 cut(s) 188
AgsI TTSAA 1 cut(s) 16
AjnI CCWGG 1 cut(s) 131
AluBI AGCT 3 cut(s) 80, 167, 226
AluI AGCT 3 cut(s) 80, 167, 226
AlwI GGATC 1 cut(s) 37
AoxI GGCC 1 cut(s) 129
ApoI RAATTY 2 cut(s) 113, 261
BalI TGGCCA 1 cut(s) 131
BccI CCATC 3 cut(s) 121, 130, 172
BciT130I CCWGG 1 cut(s) 133
BclI TGATCA 1 cut(s) 232
BfaI CTAG 1 cut(s) 75
BfuAI ACCTGC 1 cut(s) 103
Bme1390I CCNGG 1 cut(s) 133
BmrFI CCNGG 1 cut(s) 133
BmsI GCATC 1 cut(s) 229
BpuEI CTTGAG 1 cut(s) 167
BsaJI CCNNGG 1 cut(s) 247
BseBI CCWGG 1 cut(s) 133
BseDI CCNNGG 1 cut(s) 247
BseGI GGATG 3 cut(s) 141, 145, 202
BshFI GGCC 1 cut(s) 131
BsnI GGCC 1 cut(s) 131
Bsp143I GATC 2 cut(s) 29, 232
Bsp19I CCATGG 1 cut(s) 247
BspANI GGCC 1 cut(s) 131
BspMI ACCTGC 1 cut(s) 103
BspPI GGATC 1 cut(s) 37
BssECI CCNNGG 1 cut(s) 247
BssMI GATC 2 cut(s) 29, 232
BssT1I CCWWGG 1 cut(s) 247
Bst2UI CCWGG 1 cut(s) 133
BstAPI GCANNNNNTGC 2 cut(s) 95, 217
BstDSI CCRYGG 1 cut(s) 247
BstF5I GGATG 3 cut(s) 141, 145, 202
BstKTI GATC 2 cut(s) 32, 235
BstMBI GATC 2 cut(s) 29, 232
BstMWI GCNNNNNNNGC 4 cut(s) 86, 95, 208, 217
BstNI CCWGG 1 cut(s) 133
BstSCI CCNGG 1 cut(s) 131
BsuRI GGCC 1 cut(s) 131
BtgI CCRYGG 1 cut(s) 247
BtsCI GGATG 3 cut(s) 141, 145, 202
BveI ACCTGC 1 cut(s) 103
CviAII CATG 2 cut(s) 212, 248
CviJI RGCY 4 cut(s) 80, 131, 167, 226
CviKI_1 RGCY 4 cut(s) 80, 131, 167, 226
DpnI GATC 2 cut(s) 31, 234
DpnII GATC 2 cut(s) 29, 232
DraIII CACNNNGTG 1 cut(s) 188
EaeI YGGCCR 1 cut(s) 129
Eco130I CCWWGG 1 cut(s) 247
Eco57I CTGAAG 1 cut(s) 191
EcoRII CCWGG 1 cut(s) 131
EcoT14I CCWWGG 1 cut(s) 247
ErhI CCWWGG 1 cut(s) 247
FaeI CATG 2 cut(s) 215, 251
FaiI YATR 3 cut(s) 125, 213, 249
FatI CATG 2 cut(s) 211, 247
FbaI TGATCA 1 cut(s) 232
FokI GGATG 3 cut(s) 148, 152, 209
FspBI CTAG 1 cut(s) 75
HaeIII GGCC 1 cut(s) 131
Hin1II CATG 2 cut(s) 215, 251
HinfI GANTC 1 cut(s) 253
Hpy188I TCNGA 3 cut(s) 177, 232, 237
Hpy188III TCNNGA 1 cut(s) 75
HpyCH4IV ACGT 1 cut(s) 160
HpyCH4V TGCA 3 cut(s) 47, 89, 220
HpyF10VI GCNNNNNNNGC 4 cut(s) 86, 95, 208, 217
HpySE526I ACGT 1 cut(s) 160
Hsp92II CATG 2 cut(s) 215, 251
Ksp22I TGATCA 1 cut(s) 232
Kzo9I GATC 2 cut(s) 29, 232
LmnI GCTCC 1 cut(s) 12
LpnPI CCDG 3 cut(s) 108, 118, 145
LweI GCATC 1 cut(s) 229
MaeI CTAG 1 cut(s) 75
MaeII ACGT 1 cut(s) 160
MalI GATC 2 cut(s) 31, 234
MboI GATC 2 cut(s) 29, 232
MboII GAAGA 3 cut(s) 116, 122, 167
MfeI CAATTG 1 cut(s) 33
MlsI TGGCCA 1 cut(s) 131
MluCI AATT 7 cut(s) 11, 17, 33, 70, 84, 113, 261
MluNI TGGCCA 1 cut(s) 131
MnlI CCTC 1 cut(s) 187
Mox20I TGGCCA 1 cut(s) 131
MscI TGGCCA 1 cut(s) 131
MseI TTAA 1 cut(s) 20
Msp20I TGGCCA 1 cut(s) 131
MspR9I CCNGG 1 cut(s) 133
MunI CAATTG 1 cut(s) 33
MvaI CCWGG 1 cut(s) 133
MwoI GCNNNNNNNGC 4 cut(s) 86, 95, 208, 217
NcoI CCATGG 1 cut(s) 247
NdeII GATC 2 cut(s) 29, 232
NlaIII CATG 2 cut(s) 215, 251
PfeI GAWTC 1 cut(s) 253
Psp6I CCWGG 1 cut(s) 131
PspGI CCWGG 1 cut(s) 131
SaqAI TTAA 1 cut(s) 20
Sau3AI GATC 2 cut(s) 29, 232
ScrFI CCNGG 1 cut(s) 133
SetI ASST 5 cut(s) 82, 97, 163, 169, 228
SfaNI GCATC 1 cut(s) 229
SmlI CTYRAG 1 cut(s) 146
SmoI CTYRAG 1 cut(s) 146
Sse9I AATT 7 cut(s) 11, 17, 33, 70, 84, 113, 261
SspMI CTAG 1 cut(s) 75
StyD4I CCNGG 1 cut(s) 131
StyI CCWWGG 1 cut(s) 247
TaiI ACGT 1 cut(s) 163
TasI AATT 7 cut(s) 11, 17, 33, 70, 84, 113, 261
TfiI GAWTC 1 cut(s) 253
Tru1I TTAA 1 cut(s) 20
Tru9I TTAA 1 cut(s) 20
TspDTI ATGAA 3 cut(s) 117, 123, 156
XapI RAATTY 2 cut(s) 113, 261
XbaI TCTAGA 1 cut(s) 74
XspI CTAG 1 cut(s) 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.