Rroxscaffold_4G00326950

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
59241732 .. 59246496
4765 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00326950.1

Sequence Viewer

Length: 261 bp
ATGAATGATGCTACTCAAGACCATAAGAGGCTTTCAGAAAGTGTAAAAGTTGGAGCAGCTCAAGTCAAGTACGCCCAAAGAGATCATTCTGAAAAAGAAGTTGAAACTAGAGGTCAAGCTGCTGGATGCTTCACCCGACACATTAGGTGCTGCTGTCTTGGCACTACAGTACTATGCAAGTATGAGAGAACTTTAGTGGCAAAATTTCTCTCGATCACATTTGATAGTATCAGCTTTTGCTATCTTTCAATATGTAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

9.68

Weight (kDa)

8.52

Isoelectric Point (pI)

34.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 203
AfaI GTAC 2 cut(s) 71, 171
AgsI TTSAA 2 cut(s) 104, 249
AluBI AGCT 3 cut(s) 59, 119, 234
AluI AGCT 3 cut(s) 59, 119, 234
ApeKI GCWGC 3 cut(s) 56, 119, 150
ApoI RAATTY 1 cut(s) 203
AsuHPI GGTGA 1 cut(s) 124
BbvI GCAGC 3 cut(s) 68, 106, 137
BfaI CTAG 1 cut(s) 108
BfmI CTRYAG 1 cut(s) 165
BisI GCNGC 3 cut(s) 57, 120, 151
BlsI GCNGC 3 cut(s) 58, 121, 152
BmcAI AGTACT 1 cut(s) 171
BmsI GCATC 1 cut(s) 116
BpuEI CTTGAG 1 cut(s) 45
BseGI GGATG 1 cut(s) 131
BseXI GCAGC 3 cut(s) 68, 106, 137
Bsp143I GATC 2 cut(s) 82, 213
BssMI GATC 2 cut(s) 82, 213
Bst4CI ACNGT 1 cut(s) 169
BstF5I GGATG 1 cut(s) 131
BstKTI GATC 2 cut(s) 85, 216
BstMBI GATC 2 cut(s) 82, 213
BstMWI GCNNNNNNNGC 1 cut(s) 159
BstSFI CTRYAG 1 cut(s) 165
BstV1I GCAGC 3 cut(s) 68, 106, 137
BtsCI GGATG 1 cut(s) 131
Csp6I GTAC 2 cut(s) 70, 170
CviJI RGCY 4 cut(s) 31, 59, 119, 234
CviKI_1 RGCY 4 cut(s) 31, 59, 119, 234
CviQI GTAC 2 cut(s) 70, 170
DpnI GATC 2 cut(s) 84, 215
DpnII GATC 2 cut(s) 82, 213
FaiI YATR 4 cut(s) 24, 175, 183, 253
Fnu4HI GCNGC 3 cut(s) 57, 120, 151
FokI GGATG 1 cut(s) 138
Fsp4HI GCNGC 3 cut(s) 57, 120, 151
FspBI CTAG 1 cut(s) 108
GluI GCNGC 3 cut(s) 57, 120, 151
HphI GGTGA 1 cut(s) 124
Hpy188I TCNGA 2 cut(s) 37, 91
Hpy188III TCNNGA 2 cut(s) 17, 211
HpyCH4III ACNGT 1 cut(s) 169
HpyCH4V TGCA 1 cut(s) 177
HpyF10VI GCNNNNNNNGC 1 cut(s) 159
Kzo9I GATC 2 cut(s) 82, 213
LmnI GCTCC 1 cut(s) 53
LpnPI CCDG 1 cut(s) 108
Lsp1109I GCAGC 3 cut(s) 68, 106, 137
LweI GCATC 1 cut(s) 116
MaeI CTAG 1 cut(s) 108
MalI GATC 2 cut(s) 84, 215
MboI GATC 2 cut(s) 82, 213
MluCI AATT 2 cut(s) 203, 256
MmeI TCCRAC 1 cut(s) 31
MnlI CCTC 2 cut(s) 21, 104
MwoI GCNNNNNNNGC 1 cut(s) 159
NdeII GATC 2 cut(s) 82, 213
PkrI GCNGC 3 cut(s) 58, 121, 152
RsaI GTAC 2 cut(s) 71, 171
RsaNI GTAC 2 cut(s) 70, 170
SatI GCNGC 3 cut(s) 57, 120, 151
Sau3AI GATC 2 cut(s) 82, 213
ScaI AGTACT 1 cut(s) 171
SetI ASST 5 cut(s) 61, 115, 121, 149, 236
SfaNI GCATC 1 cut(s) 116
SfcI CTRYAG 1 cut(s) 165
SmlI CTYRAG 2 cut(s) 15, 60
SmoI CTYRAG 2 cut(s) 15, 60
Sse9I AATT 2 cut(s) 203, 256
SspMI CTAG 1 cut(s) 108
TaaI ACNGT 1 cut(s) 169
TaqI TCGA 1 cut(s) 212
TasI AATT 2 cut(s) 203, 256
TatI WGTACW 1 cut(s) 169
TseI GCWGC 3 cut(s) 56, 119, 150
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 203
XspI CTAG 1 cut(s) 108
ZrmI AGTACT 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.