Rh2CG183800

OTU domain-containing protein DDB_G0284757-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
17048697 .. 17049430
734 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG183800.1

Sequence Viewer

Length: 162 bp
ATGGGATTCCAAGACCAAGTTCTCCAAACCATTCGAAGGGACAGAAGGTTTGGAGCCAAAATTTGTTTAATCACCTCTCTTCGGGATACTTGCTACATTGAGATCCTTCCTAAAGACAGGAATCCTACACAAGGTATATCTCATTTGCTTACTGCATCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

53

Amino Acids

6.09

Weight (kDa)

9.38

Isoelectric Point (pI)

56.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 97
AcsI RAATTY 1 cut(s) 60
AfiI CCNNNNNNNGG 3 cut(s) 36, 81, 131
AjuI GAANNNNNNNTTGG 1 cut(s) 35
AlwI GGATC 1 cut(s) 97
ApoI RAATTY 1 cut(s) 60
ArsI GACNNNNNNTTYG 2 cut(s) 32, 64
AsuHPI GGTGA 1 cut(s) 64
AsuII TTCGAA 1 cut(s) 34
BciVI GTATCC 1 cut(s) 79
BfuI GTATCC 1 cut(s) 79
BmiI GGNNCC 1 cut(s) 55
Bpu14I TTCGAA 1 cut(s) 34
Bsc4I CCNNNNNNNGG 3 cut(s) 36, 81, 131
BseLI CCNNNNNNNGG 3 cut(s) 36, 81, 131
BslFI GGGAC 1 cut(s) 53
BslI CCNNNNNNNGG 3 cut(s) 36, 81, 131
BsmFI GGGAC 1 cut(s) 53
Bsp119I TTCGAA 1 cut(s) 34
Bsp143I GATC 1 cut(s) 102
BspLI GGNNCC 1 cut(s) 55
BspPI GGATC 1 cut(s) 97
BspT104I TTCGAA 1 cut(s) 34
BssMI GATC 1 cut(s) 102
Bst6I CTCTTC 1 cut(s) 84
BstBI TTCGAA 1 cut(s) 34
BstENI CCTNNNNNAGG 1 cut(s) 129
BstKTI GATC 1 cut(s) 105
BstMBI GATC 1 cut(s) 102
BstX2I RGATCY 1 cut(s) 102
BstYI RGATCY 1 cut(s) 102
BsuI GTATCC 1 cut(s) 79
CviJI RGCY 1 cut(s) 56
CviKI_1 RGCY 1 cut(s) 56
DpnI GATC 1 cut(s) 104
DpnII GATC 1 cut(s) 102
Eam1104I CTCTTC 1 cut(s) 84
EarI CTCTTC 1 cut(s) 84
EcoNI CCTNNNNNAGG 1 cut(s) 129
FaiI YATR 1 cut(s) 137
FaqI GGGAC 1 cut(s) 53
HinfI GANTC 2 cut(s) 6, 121
HphI GGTGA 1 cut(s) 64
Hpy188III TCNNGA 1 cut(s) 83
HpyAV CCTTC 3 cut(s) 30, 39, 116
HpyCH4V TGCA 1 cut(s) 155
Kzo9I GATC 1 cut(s) 102
LmnI GCTCC 1 cut(s) 53
LpnPI CCDG 1 cut(s) 103
MalI GATC 1 cut(s) 104
MboI GATC 1 cut(s) 102
MboII GAAGA 1 cut(s) 71
MflI RGATCY 1 cut(s) 102
MluCI AATT 1 cut(s) 60
MnlI CCTC 1 cut(s) 85
MseI TTAA 2 cut(s) 68, 160
NdeII GATC 1 cut(s) 102
NlaIV GGNNCC 1 cut(s) 55
NspV TTCGAA 1 cut(s) 34
PfeI GAWTC 2 cut(s) 6, 121
PspN4I GGNNCC 1 cut(s) 55
PsuI RGATCY 1 cut(s) 102
SaqAI TTAA 2 cut(s) 68, 160
Sau3AI GATC 1 cut(s) 102
SetI ASST 3 cut(s) 50, 77, 136
SfuI TTCGAA 1 cut(s) 34
SgeI CNNG 6 cut(s) 23, 29, 95, 102, 130, 143
Sse9I AATT 1 cut(s) 60
TaqI TCGA 1 cut(s) 34
TasI AATT 1 cut(s) 60
TfiI GAWTC 2 cut(s) 6, 121
Tru1I TTAA 2 cut(s) 68, 160
Tru9I TTAA 2 cut(s) 68, 160
XagI CCTNNNNNAGG 1 cut(s) 129
XapI RAATTY 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.