Rroxscaffold_7G00158920
ERF Family

Belongs to the TRAFAC class dynamin-like GTPase superfamily. Dynamin Fzo YdjA family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
2257799 .. 2261408
3610 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00158920.1

Sequence Viewer

Length: 165 bp
ATGATCTCCGGTGTTCCAATTCATCTTAGCATATATTCTCCTGATGCTAAGATAATGGTTATCAACTTGACACTTTTTGATCTTCCTGGGCTTACAAAAGTTGTCATTGGATCAATGAAGTCTTCTGCTATACTAGATGAATCACTGGTGCATTCAAACAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

5.78

Weight (kDa)

5.97

Isoelectric Point (pI)

35.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 118
AgsI TTSAA 1 cut(s) 156
AjnI CCWGG 1 cut(s) 85
AlwI GGATC 1 cut(s) 118
BbsI GAAGAC 1 cut(s) 114
BciT130I CCWGG 1 cut(s) 87
BfaI CTAG 1 cut(s) 134
Bme1390I CCNGG 1 cut(s) 87
BmrFI CCNGG 1 cut(s) 87
BmsI GCATC 1 cut(s) 34
BpiI GAAGAC 1 cut(s) 114
BsaJI CCNNGG 1 cut(s) 86
BsaWI WCCGGW 1 cut(s) 8
Bse1I ACTGG 1 cut(s) 150
BseBI CCWGG 1 cut(s) 87
BseDI CCNNGG 1 cut(s) 86
BseNI ACTGG 1 cut(s) 150
BsiSI CCGG 1 cut(s) 9
BsmI GAATGC 1 cut(s) 151
Bsp143I GATC 3 cut(s) 3, 79, 110
BspPI GGATC 1 cut(s) 118
BsrI ACTGG 1 cut(s) 150
BssECI CCNNGG 1 cut(s) 86
BssMI GATC 3 cut(s) 3, 79, 110
Bst2UI CCWGG 1 cut(s) 87
BstDEI CTNAG 2 cut(s) 26, 48
BstKTI GATC 3 cut(s) 6, 82, 113
BstMBI GATC 3 cut(s) 3, 79, 110
BstNI CCWGG 1 cut(s) 87
BstSCI CCNGG 1 cut(s) 85
BstV2I GAAGAC 1 cut(s) 114
BtsIMutI CAGTG 1 cut(s) 143
CviJI RGCY 1 cut(s) 91
CviKI_1 RGCY 1 cut(s) 91
DdeI CTNAG 2 cut(s) 26, 48
DpnI GATC 3 cut(s) 5, 81, 112
DpnII GATC 3 cut(s) 3, 79, 110
EcoRII CCWGG 1 cut(s) 85
FaiI YATR 3 cut(s) 32, 34, 131
FspBI CTAG 1 cut(s) 134
FspEI CC 9 cut(s) 22, 30, 41, 54, 72, 73, 93, 99, 131
HapII CCGG 1 cut(s) 9
HinfI GANTC 1 cut(s) 140
HpaII CCGG 1 cut(s) 9
Hpy188III TCNNGA 1 cut(s) 41
HpyCH4V TGCA 1 cut(s) 151
HpyF3I CTNAG 2 cut(s) 26, 48
Kzo9I GATC 3 cut(s) 3, 79, 110
LpnPI CCDG 5 cut(s) 22, 54, 72, 99, 131
LweI GCATC 1 cut(s) 34
MaeI CTAG 1 cut(s) 134
MalI GATC 3 cut(s) 5, 81, 112
MboI GATC 3 cut(s) 3, 79, 110
MboII GAAGA 2 cut(s) 74, 114
MfeI CAATTG 1 cut(s) 160
MluCI AATT 2 cut(s) 18, 160
MspI CCGG 1 cut(s) 9
MspR9I CCNGG 1 cut(s) 87
MunI CAATTG 1 cut(s) 160
Mva1269I GAATGC 1 cut(s) 151
MvaI CCWGG 1 cut(s) 87
NdeII GATC 3 cut(s) 3, 79, 110
PctI GAATGC 1 cut(s) 151
PfeI GAWTC 1 cut(s) 140
Psp6I CCWGG 1 cut(s) 85
PspGI CCWGG 1 cut(s) 85
Sau3AI GATC 3 cut(s) 3, 79, 110
ScrFI CCNGG 1 cut(s) 87
SfaNI GCATC 1 cut(s) 34
SgeI CNNG 7 cut(s) 21, 53, 79, 98, 99, 146, 158
Sse9I AATT 2 cut(s) 18, 160
SspMI CTAG 1 cut(s) 134
StyD4I CCNGG 1 cut(s) 85
TasI AATT 2 cut(s) 18, 160
TfiI GAWTC 1 cut(s) 140
TscAI CASTG 1 cut(s) 150
TspDTI ATGAA 3 cut(s) 11, 131, 153
TspRI CASTG 1 cut(s) 150
XspI CTAG 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.