Rorug01G0119200

4-coumarate--CoA ligase-like

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
20839648 .. 20841294
1647 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0119200.1

Sequence Viewer

Length: 291 bp
ATGCTTTCCATTGATTATCAATATCGATCATCACTAAGGATGTGTTTTTTAAACTTGATTGGAATATTGTCTCAAGAATACAAACATGGCAAAGAGAACAGATGCAGGACTTTGGAATATGAAGTTGCTGATTCTTTGATTTTATATCATCCACATGTCTATAAGAGTACAATAAACTATACTAATTGTTTCCCTATGCGAAATTGGGAATTTGGAGCATGCAGGAATGATTTTCAATGGAACTTCTATTCTTTTTCTACGATAATGGACACAAGACTATTCAGGGTATGA

Protein Analysis

96

Amino Acids

11.7

Weight (kDa)

8.39

Isoelectric Point (pI)

25.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 209
AfaI GTAC 1 cut(s) 169
AflIII ACRYGT 1 cut(s) 154
AgsI TTSAA 1 cut(s) 236
Alw26I GTCTC 1 cut(s) 75
ApoI RAATTY 1 cut(s) 209
BcoDI GTCTC 1 cut(s) 75
BmsI GCATC 1 cut(s) 92
BpuEI CTTGAG 1 cut(s) 57
Bsa29I ATCGAT 1 cut(s) 25
BseCI ATCGAT 1 cut(s) 25
BseGI GGATG 2 cut(s) 45, 148
BshVI ATCGAT 1 cut(s) 25
BsmAI GTCTC 1 cut(s) 75
Bsp143I GATC 1 cut(s) 26
BspDI ATCGAT 1 cut(s) 25
BssMI GATC 1 cut(s) 26
BstC8I GCNNGC 1 cut(s) 220
BstDEI CTNAG 1 cut(s) 35
BstF5I GGATG 2 cut(s) 45, 148
BstKTI GATC 1 cut(s) 29
BstMAI GTCTC 1 cut(s) 75
BstMBI GATC 1 cut(s) 26
BstNSI RCATGY 2 cut(s) 158, 222
Bsu15I ATCGAT 1 cut(s) 25
BsuTUI ATCGAT 1 cut(s) 25
BtsCI GGATG 2 cut(s) 45, 148
Cac8I GCNNGC 1 cut(s) 220
ClaI ATCGAT 1 cut(s) 25
Csp6I GTAC 1 cut(s) 168
CviAII CATG 3 cut(s) 86, 155, 219
CviQI GTAC 1 cut(s) 168
DdeI CTNAG 1 cut(s) 35
DpnI GATC 1 cut(s) 28
DpnII GATC 1 cut(s) 26
DraI TTTAAA 1 cut(s) 51
FaeI CATG 3 cut(s) 89, 158, 222
FaiI YATR 9 cut(s) 87, 120, 145, 156, 162, 180, 197, 220, 289
FatI CATG 3 cut(s) 85, 154, 218
FokI GGATG 2 cut(s) 52, 135
Hin1II CATG 3 cut(s) 89, 158, 222
HinfI GANTC 1 cut(s) 131
Hpy188III TCNNGA 1 cut(s) 74
HpyCH4V TGCA 2 cut(s) 105, 222
HpyF3I CTNAG 1 cut(s) 35
Hsp92II CATG 3 cut(s) 89, 158, 222
Kzo9I GATC 1 cut(s) 26
LmnI GCTCC 1 cut(s) 215
LpnPI CCDG 3 cut(s) 91, 208, 268
LweI GCATC 1 cut(s) 92
MalI GATC 1 cut(s) 28
MboI GATC 1 cut(s) 26
MluCI AATT 3 cut(s) 184, 202, 209
MseI TTAA 1 cut(s) 50
MslI CAYNNNNRTG 1 cut(s) 153
NdeII GATC 1 cut(s) 26
NlaIII CATG 3 cut(s) 89, 158, 222
NspI RCATGY 2 cut(s) 158, 222
PaeI GCATGC 1 cut(s) 222
PciI ACATGT 1 cut(s) 154
PfeI GAWTC 1 cut(s) 131
PscI ACATGT 1 cut(s) 154
RsaI GTAC 1 cut(s) 169
RsaNI GTAC 1 cut(s) 168
RseI CAYNNNNRTG 1 cut(s) 153
SaqAI TTAA 1 cut(s) 50
Sau3AI GATC 1 cut(s) 26
SfaNI GCATC 1 cut(s) 92
SgeI CNNG 8 cut(s) 67, 86, 98, 118, 167, 231, 235, 285
SmiMI CAYNNNNRTG 1 cut(s) 153
SmlI CTYRAG 1 cut(s) 72
SmoI CTYRAG 1 cut(s) 72
SphI GCATGC 1 cut(s) 222
Sse9I AATT 3 cut(s) 184, 202, 209
SspI AATATT 1 cut(s) 66
TaqI TCGA 1 cut(s) 25
TasI AATT 3 cut(s) 184, 202, 209
TatI WGTACW 1 cut(s) 167
TfiI GAWTC 1 cut(s) 131
Tru1I TTAA 1 cut(s) 50
Tru9I TTAA 1 cut(s) 50
TspDTI ATGAA 1 cut(s) 135
XapI RAATTY 1 cut(s) 209
XceI RCATGY 2 cut(s) 158, 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.