Rorug01G0196300

plastid-lipid-associated protein 11

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Forward (+)
27523089 .. 27523391
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0196300.1

Sequence Viewer

Length: 303 bp
ATGCTCCATTACGCTTACCACGCCGTCAAGAAGTCCATTGAGGCATATATCACTCGCACCGACGGGTATGTCATTGAGGTACCTTTGCCATTTCCTTTGAATTCTAATGATGAGATTGTAACCGAGTTTAAGGAAGCTTTGGAAAAAGGGAAGGCGAATGGGACGAGGGTTAGGCTAGTTGTGATTGATCATATTACTATTGGCCTTGTGTGGTTATACCTGTTAAGGAGTTGGTTAAGATTTGTAGGGAGGAGGGGGTTGATTAGGTTTTCATCGATGCAGCTCACAACATTGGGTATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.52

Weight (kDa)

9.63

Isoelectric Point (pI)

49.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 68
Acc65I GGTACC 1 cut(s) 79
AccB1I GGYRCC 1 cut(s) 79
AcsI RAATTY 1 cut(s) 100
AfaI GTAC 1 cut(s) 81
AgsI TTSAA 1 cut(s) 100
AluBI AGCT 2 cut(s) 137, 283
AluI AGCT 2 cut(s) 137, 283
AoxI GGCC 1 cut(s) 202
ApeKI GCWGC 1 cut(s) 280
ApoI RAATTY 1 cut(s) 100
Asp718I GGTACC 1 cut(s) 79
BanI GGYRCC 1 cut(s) 79
BbvI GCAGC 1 cut(s) 292
BceAI ACGGC 1 cut(s) 8
BclI TGATCA 1 cut(s) 187
BfaI CTAG 1 cut(s) 176
BisI GCNGC 1 cut(s) 281
BlsI GCNGC 1 cut(s) 282
BmiI GGNNCC 1 cut(s) 81
BmsI GCATC 1 cut(s) 267
Bsa29I ATCGAT 1 cut(s) 275
BseCI ATCGAT 1 cut(s) 275
BseRI GAGGAG 1 cut(s) 265
BseXI GCAGC 1 cut(s) 292
BshFI GGCC 1 cut(s) 204
BshNI GGYRCC 1 cut(s) 79
BshVI ATCGAT 1 cut(s) 275
BslFI GGGAC 1 cut(s) 175
BsmFI GGGAC 1 cut(s) 175
BsnI GGCC 1 cut(s) 204
Bsp143I GATC 1 cut(s) 187
BspANI GGCC 1 cut(s) 204
BspDI ATCGAT 1 cut(s) 275
BspLI GGNNCC 1 cut(s) 81
BspT107I GGYRCC 1 cut(s) 79
BssMI GATC 1 cut(s) 187
BstKTI GATC 1 cut(s) 190
BstMBI GATC 1 cut(s) 187
BstMWI GCNNNNNNNGC 1 cut(s) 20
BstV1I GCAGC 1 cut(s) 292
Bsu15I ATCGAT 1 cut(s) 275
BsuRI GGCC 1 cut(s) 204
BsuTUI ATCGAT 1 cut(s) 275
ClaI ATCGAT 1 cut(s) 275
Csp6I GTAC 1 cut(s) 80
CviJI RGCY 4 cut(s) 137, 175, 204, 283
CviKI_1 RGCY 4 cut(s) 137, 175, 204, 283
CviQI GTAC 1 cut(s) 80
DpnI GATC 1 cut(s) 189
DpnII GATC 1 cut(s) 187
DrdI GACNNNNNNGTC 1 cut(s) 68
DseDI GACNNNNNNGTC 1 cut(s) 68
EcoRI GAATTC 1 cut(s) 100
FaiI YATR 7 cut(s) 46, 48, 69, 192, 217, 299, 301
FaqI GGGAC 1 cut(s) 175
FbaI TGATCA 1 cut(s) 187
Fnu4HI GCNGC 1 cut(s) 281
Fsp4HI GCNGC 1 cut(s) 281
FspBI CTAG 1 cut(s) 176
GluI GCNGC 1 cut(s) 281
HaeIII GGCC 1 cut(s) 204
HindIII AAGCTT 1 cut(s) 135
Hpy188III TCNNGA 1 cut(s) 28
Hpy99I CGWCG 1 cut(s) 65
HpyAV CCTTC 1 cut(s) 145
HpyCH4V TGCA 1 cut(s) 280
HpyF10VI GCNNNNNNNGC 1 cut(s) 20
KpnI GGTACC 1 cut(s) 83
Ksp22I TGATCA 1 cut(s) 187
Kzo9I GATC 1 cut(s) 187
LmnI GCTCC 1 cut(s) 9
LpnPI CCDG 1 cut(s) 233
Lsp1109I GCAGC 1 cut(s) 292
LweI GCATC 1 cut(s) 267
MaeI CTAG 1 cut(s) 176
MaeIII GTNAC 1 cut(s) 118
MalI GATC 1 cut(s) 189
MboI GATC 1 cut(s) 187
MluCI AATT 1 cut(s) 100
MnlI CCTC 5 cut(s) 34, 70, 159, 243, 246
MseI TTAA 3 cut(s) 129, 224, 236
MwoI GCNNNNNNNGC 1 cut(s) 20
NdeII GATC 1 cut(s) 187
NlaIV GGNNCC 1 cut(s) 81
PkrI GCNGC 1 cut(s) 282
PspN4I GGNNCC 1 cut(s) 81
RsaI GTAC 1 cut(s) 81
RsaNI GTAC 1 cut(s) 80
SaqAI TTAA 3 cut(s) 129, 224, 236
SatI GCNGC 1 cut(s) 281
Sau3AI GATC 1 cut(s) 187
SetI ASST 6 cut(s) 81, 85, 139, 222, 269, 285
SfaNI GCATC 1 cut(s) 267
SgeI CNNG 9 cut(s) 32, 40, 66, 76, 136, 177, 188, 218, 232
Sse9I AATT 1 cut(s) 100
SspMI CTAG 1 cut(s) 176
TaqI TCGA 1 cut(s) 275
TasI AATT 1 cut(s) 100
Tru1I TTAA 3 cut(s) 129, 224, 236
Tru9I TTAA 3 cut(s) 129, 224, 236
TseI GCWGC 1 cut(s) 280
TspDTI ATGAA 1 cut(s) 261
XapI RAATTY 1 cut(s) 100
XspI CTAG 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.