Rorug01G0269700

Mitochondrial inner membrane protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
38254913 .. 38255158
246 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0269700.1

Sequence Viewer

Length: 246 bp
ATGGACATGACATTGATTGGGATATTATCTGTCCCGAAATTGGTTTTACATGTGGGTTTGGGATTGTTATCGGGTCACTTTTGTTTTGCAAGAGATGGAGGAAGTGGTATTACAGAGCTATGTATAACATGCTTAGAAAGATATTCCCTCTGCTGGAACAAATATTTGGTCGTCGCAGGAGACATGTTTATGTCCATCAAAGATACTGGAGACGTTGAAAATGGTTGTGAAGATCAATGCACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Pfam Domains
Protein Families

Protein Analysis

81

Amino Acids

8.81

Weight (kDa)

4.59

Isoelectric Point (pI)

26.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 40, 153
AflIII ACRYGT 2 cut(s) 49, 183
AgsI TTSAA 1 cut(s) 218
AjuI GAANNNNNNNTTGG 2 cut(s) 149, 181
AluBI AGCT 1 cut(s) 118
AluI AGCT 1 cut(s) 118
Alw26I GTCTC 2 cut(s) 174, 204
ArsI GACNNNNNNTTYG 2 cut(s) 153, 185
BarI GAAGNNNNNNTAC 2 cut(s) 94, 126
BccI CCATC 2 cut(s) 89, 203
BcoDI GTCTC 2 cut(s) 174, 204
BpmI CTGGAG 1 cut(s) 228
BsaBI GATNNNNATC 1 cut(s) 67
Bsc4I CCNNNNNNNGG 2 cut(s) 40, 153
Bse1I ACTGG 1 cut(s) 211
Bse8I GATNNNNATC 1 cut(s) 67
BseJI GATNNNNATC 1 cut(s) 67
BseLI CCNNNNNNNGG 2 cut(s) 40, 153
BseNI ACTGG 1 cut(s) 211
BslFI GGGAC 1 cut(s) 17
BslI CCNNNNNNNGG 2 cut(s) 40, 153
BsmAI GTCTC 2 cut(s) 174, 204
BsmBI CGTCTC 1 cut(s) 204
BsmFI GGGAC 1 cut(s) 17
Bsp143I GATC 1 cut(s) 232
BsrI ACTGG 1 cut(s) 211
BssMI GATC 1 cut(s) 232
BstDEI CTNAG 1 cut(s) 133
BstKTI GATC 1 cut(s) 235
BstMAI GTCTC 2 cut(s) 174, 204
BstMBI GATC 1 cut(s) 232
BstNSI RCATGY 3 cut(s) 53, 132, 187
CviAII CATG 4 cut(s) 7, 50, 129, 184
CviJI RGCY 1 cut(s) 118
CviKI_1 RGCY 1 cut(s) 118
DdeI CTNAG 1 cut(s) 133
DpnI GATC 1 cut(s) 234
DpnII GATC 1 cut(s) 232
Esp3I CGTCTC 1 cut(s) 204
FaeI CATG 4 cut(s) 10, 53, 132, 187
FaiI YATR 7 cut(s) 8, 51, 121, 125, 130, 185, 191
FaqI GGGAC 1 cut(s) 17
FatI CATG 4 cut(s) 6, 49, 128, 183
GsuI CTGGAG 1 cut(s) 228
Hin1II CATG 4 cut(s) 10, 53, 132, 187
Hpy188III TCNNGA 1 cut(s) 34
Hpy99I CGWCG 1 cut(s) 176
HpyCH4IV ACGT 1 cut(s) 213
HpyCH4V TGCA 2 cut(s) 89, 240
HpyF3I CTNAG 1 cut(s) 133
HpySE526I ACGT 1 cut(s) 213
Hsp92II CATG 4 cut(s) 10, 53, 132, 187
Kzo9I GATC 1 cut(s) 232
LpnPI CCDG 3 cut(s) 139, 162, 192
MaeII ACGT 1 cut(s) 213
MaeIII GTNAC 1 cut(s) 74
MalI GATC 1 cut(s) 234
MboI GATC 1 cut(s) 232
MboII GAAGA 1 cut(s) 242
MluCI AATT 1 cut(s) 38
MnlI CCTC 2 cut(s) 92, 158
MslI CAYNNNNRTG 1 cut(s) 188
NdeII GATC 1 cut(s) 232
NlaIII CATG 4 cut(s) 10, 53, 132, 187
NmuCI GTSAC 1 cut(s) 74
NspI RCATGY 3 cut(s) 53, 132, 187
PciI ACATGT 2 cut(s) 49, 183
PscI ACATGT 2 cut(s) 49, 183
RseI CAYNNNNRTG 1 cut(s) 188
Sau3AI GATC 1 cut(s) 232
SetI ASST 3 cut(s) 120, 216, 245
SmiMI CAYNNNNRTG 1 cut(s) 188
Sse9I AATT 1 cut(s) 38
SspI AATATT 1 cut(s) 164
TaiI ACGT 1 cut(s) 216
TasI AATT 1 cut(s) 38
TseFI GTSAC 1 cut(s) 74
Tsp45I GTSAC 1 cut(s) 74
XceI RCATGY 3 cut(s) 53, 132, 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.