Rorug03G0242100

Homeobox-leucine zipper protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
22575782 .. 22576003
222 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0242100.1

Sequence Viewer

Length: 222 bp
ATGGCCATCAAAGAGGGTCTAAAACTACTTCAATCGTTACAGGTTGGTAATGTGGTCATTGAAACTGATTGCCTTGAGGCTACATATGATATTGCTAATGTTAATTATGAGCTTGGAGCTATTGGAGGTCTAATAGATGACATAAAAATGGCCATGAGTACCATGCAGAATGTTTCAATATGTCATGCTCCAAGAACATGTAATGGAGTGACAAAAGACTAG

Protein Analysis

73

Amino Acids

7.84

Weight (kDa)

4.64

Isoelectric Point (pI)

43.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 2 - 70 4.1e-08 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 2 cut(s) 3, 150
AfaI GTAC 1 cut(s) 160
AflIII ACRYGT 1 cut(s) 197
AgsI TTSAA 3 cut(s) 32, 62, 177
AluBI AGCT 2 cut(s) 112, 119
AluI AGCT 2 cut(s) 112, 119
AoxI GGCC 2 cut(s) 3, 150
BalI TGGCCA 2 cut(s) 5, 152
BccI CCATC 1 cut(s) 14
BfaI CTAG 1 cut(s) 220
BpuEI CTTGAG 1 cut(s) 95
BshFI GGCC 2 cut(s) 5, 152
BsnI GGCC 2 cut(s) 5, 152
BspANI GGCC 2 cut(s) 5, 152
BstNSI RCATGY 1 cut(s) 201
BsuRI GGCC 2 cut(s) 5, 152
Csp6I GTAC 1 cut(s) 159
CviAII CATG 4 cut(s) 154, 163, 185, 198
CviJI RGCY 5 cut(s) 5, 80, 112, 119, 152
CviKI_1 RGCY 5 cut(s) 5, 80, 112, 119, 152
CviQI GTAC 1 cut(s) 159
EaeI YGGCCR 2 cut(s) 3, 150
FaeI CATG 4 cut(s) 157, 166, 188, 201
FaiI YATR 9 cut(s) 85, 87, 108, 143, 155, 164, 181, 186, 199
FatI CATG 4 cut(s) 153, 162, 184, 197
FauNDI CATATG 1 cut(s) 85
FspBI CTAG 1 cut(s) 220
HaeIII GGCC 2 cut(s) 5, 152
Hin1II CATG 4 cut(s) 157, 166, 188, 201
HpyCH4V TGCA 1 cut(s) 166
Hsp92II CATG 4 cut(s) 157, 166, 188, 201
LmnI GCTCC 2 cut(s) 116, 193
LpnPI CCDG 1 cut(s) 26
MaeI CTAG 1 cut(s) 220
MaeIII GTNAC 2 cut(s) 36, 208
MlsI TGGCCA 2 cut(s) 5, 152
MluCI AATT 1 cut(s) 103
MluNI TGGCCA 2 cut(s) 5, 152
MnlI CCTC 3 cut(s) 7, 70, 119
Mox20I TGGCCA 2 cut(s) 5, 152
MscI TGGCCA 2 cut(s) 5, 152
MseI TTAA 1 cut(s) 102
MslI CAYNNNNRTG 1 cut(s) 146
Msp20I TGGCCA 2 cut(s) 5, 152
NdeI CATATG 1 cut(s) 85
NlaIII CATG 4 cut(s) 157, 166, 188, 201
NmuCI GTSAC 1 cut(s) 208
NspI RCATGY 1 cut(s) 201
PciI ACATGT 1 cut(s) 197
PscI ACATGT 1 cut(s) 197
RsaI GTAC 1 cut(s) 160
RsaNI GTAC 1 cut(s) 159
RseI CAYNNNNRTG 1 cut(s) 146
SaqAI TTAA 1 cut(s) 102
SetI ASST 4 cut(s) 45, 114, 121, 130
SgeI CNNG 8 cut(s) 53, 86, 125, 166, 175, 197, 204, 210
SmiMI CAYNNNNRTG 1 cut(s) 146
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
Sse9I AATT 1 cut(s) 103
SspMI CTAG 1 cut(s) 220
TasI AATT 1 cut(s) 103
Tru1I TTAA 1 cut(s) 102
Tru9I TTAA 1 cut(s) 102
TseFI GTSAC 1 cut(s) 208
Tsp45I GTSAC 1 cut(s) 208
XceI RCATGY 1 cut(s) 201
XspI CTAG 1 cut(s) 220
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.