Rorug04G0319300

Belongs to the endosulfine family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Forward (+)
49323654 .. 49325442
1789 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0319300.1

Sequence Viewer

Length: 177 bp
ATGGGAAACTATTTCTTATGCGGTGTAGATGCTGTTAGCTTGCATGTTAAATTTGTGTTGAACTTCTGGAAATGTCACTTGCAGAATGAGGCTGTCCTGAAAGCATGTGCCGAACCACCTCCTTCAAAATCGTCAGGGGCTGATGCTAGTGAAGTTGTGAGAAAGACAACTGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.32

Weight (kDa)

6.7

Isoelectric Point (pI)

40.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 21
AcsI RAATTY 1 cut(s) 50
AgsI TTSAA 2 cut(s) 61, 126
AluBI AGCT 1 cut(s) 39
AluI AGCT 1 cut(s) 39
AlwNI CAGNNNCTG 1 cut(s) 140
ApoI RAATTY 1 cut(s) 50
BfaI CTAG 1 cut(s) 147
BmsI GCATC 2 cut(s) 19, 133
BspACI CCGC 1 cut(s) 21
BstC8I GCNNGC 1 cut(s) 41
BstNSI RCATGY 2 cut(s) 47, 108
Cac8I GCNNGC 1 cut(s) 41
CaiI CAGNNNCTG 1 cut(s) 140
CviAII CATG 2 cut(s) 44, 105
CviJI RGCY 3 cut(s) 39, 92, 140
CviKI_1 RGCY 3 cut(s) 39, 92, 140
FaeI CATG 2 cut(s) 47, 108
FaiI YATR 3 cut(s) 19, 45, 106
FatI CATG 2 cut(s) 43, 104
FspBI CTAG 1 cut(s) 147
Hin1II CATG 2 cut(s) 47, 108
Hpy188III TCNNGA 2 cut(s) 67, 97
HpyAV CCTTC 1 cut(s) 132
HpyCH4V TGCA 2 cut(s) 43, 82
Hsp92II CATG 2 cut(s) 47, 108
LpnPI CCDG 3 cut(s) 52, 110, 120
LweI GCATC 2 cut(s) 19, 133
MaeI CTAG 1 cut(s) 147
MaeIII GTNAC 1 cut(s) 74
MluCI AATT 1 cut(s) 50
MnlI CCTC 2 cut(s) 82, 129
MseI TTAA 1 cut(s) 48
NlaIII CATG 2 cut(s) 47, 108
NmuCI GTSAC 1 cut(s) 74
NspI RCATGY 2 cut(s) 47, 108
PstNI CAGNNNCTG 1 cut(s) 140
SaqAI TTAA 1 cut(s) 48
SetI ASST 2 cut(s) 41, 121
SfaNI GCATC 2 cut(s) 19, 133
SgeI CNNG 8 cut(s) 52, 56, 79, 91, 109, 117, 147, 159
Sse9I AATT 1 cut(s) 50
SsiI CCGC 1 cut(s) 21
SspMI CTAG 1 cut(s) 147
TasI AATT 1 cut(s) 50
Tru1I TTAA 1 cut(s) 48
Tru9I TTAA 1 cut(s) 48
TseFI GTSAC 1 cut(s) 74
Tsp45I GTSAC 1 cut(s) 74
XapI RAATTY 1 cut(s) 50
XceI RCATGY 2 cut(s) 47, 108
XspI CTAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.