Rorug07G0262800

Non-catalytic subunit of the queuine tRNA- ribosyltransferase (TGT) that catalyzes the base-exchange of a guanine (G) residue with queuine (Q) at position 34 (anticodon wobble position) in tRNAs with GU(N) anticodons (tRNA-Asp, -Asn, - His and -Tyr), resulting in the hypermodified nucleoside queuosine (7-(((4,5-cis-dihydroxy-2-cyclopenten-1-yl)amino)methyl)-7- deazaguanosine)

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
Physical Location & Seq
Forward (+)
24713771 .. 24714067
297 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0262800.1

Sequence Viewer

Length: 297 bp
ATGTCCCCCAGAATATTCAAATGGGGGGAGGCTAGTAAAGAATCCGATGTGTTAAGTTTTGGAGTTGTGGCCTTGGAACTTTCTTGTGGAAAGAGGACTCACCAGGATGGAGAATATCATGTGCCACTTTTCCTTTGGGTTTGGTCACTTAAACTTGAAGGGAGACTTCTGGATGTAGCTGATGAGAGATTGGAAATGACTTTTGGGCAAAGGGAAATGGAATGTTTGCTAGTTGTGGGATTATGGTACACTAACCCCAACAGCAACAGATGGCCAAAAGCTGAACAAGGTTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

98

Amino Acids

11.38

Weight (kDa)

5.33

Isoelectric Point (pI)

39.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 272
AfaI GTAC 1 cut(s) 248
AgsI TTSAA 2 cut(s) 19, 158
AjnI CCWGG 1 cut(s) 102
AjuI GAANNNNNNNTTGG 2 cut(s) 186, 218
AluBI AGCT 2 cut(s) 179, 281
AluI AGCT 2 cut(s) 179, 281
Alw26I GTCTC 1 cut(s) 157
AoxI GGCC 2 cut(s) 69, 272
AsuHPI GGTGA 1 cut(s) 92
BalI TGGCCA 1 cut(s) 274
BccI CCATC 2 cut(s) 101, 264
BciT130I CCWGG 1 cut(s) 104
BcoDI GTCTC 1 cut(s) 157
BfaI CTAG 2 cut(s) 33, 230
Bme1390I CCNGG 1 cut(s) 104
BmrFI CCNGG 1 cut(s) 104
BsaJI CCNNGG 1 cut(s) 72
BseBI CCWGG 1 cut(s) 104
BseDI CCNNGG 1 cut(s) 72
BseGI GGATG 2 cut(s) 112, 178
BshFI GGCC 2 cut(s) 71, 274
BsmAI GTCTC 1 cut(s) 157
BsnI GGCC 2 cut(s) 71, 274
BspANI GGCC 2 cut(s) 71, 274
BssECI CCNNGG 1 cut(s) 72
BssT1I CCWWGG 1 cut(s) 72
Bst2UI CCWGG 1 cut(s) 104
BstF5I GGATG 2 cut(s) 112, 178
BstMAI GTCTC 1 cut(s) 157
BstNI CCWGG 1 cut(s) 104
BstSCI CCNGG 1 cut(s) 102
BsuRI GGCC 2 cut(s) 71, 274
BtsCI GGATG 2 cut(s) 112, 178
Csp6I GTAC 1 cut(s) 247
CviAII CATG 1 cut(s) 119
CviJI RGCY 5 cut(s) 32, 71, 179, 274, 281
CviKI_1 RGCY 5 cut(s) 32, 71, 179, 274, 281
CviQI GTAC 1 cut(s) 247
EaeI YGGCCR 1 cut(s) 272
Eco130I CCWWGG 1 cut(s) 72
EcoRII CCWGG 1 cut(s) 102
EcoT14I CCWWGG 1 cut(s) 72
ErhI CCWWGG 1 cut(s) 72
FaeI CATG 1 cut(s) 122
FaiI YATR 2 cut(s) 120, 244
FalI AAGNNNNNCTT 2 cut(s) 150, 182
FatI CATG 1 cut(s) 118
FokI GGATG 2 cut(s) 119, 185
FspBI CTAG 2 cut(s) 33, 230
HaeIII GGCC 2 cut(s) 71, 274
Hin1II CATG 1 cut(s) 122
HinfI GANTC 2 cut(s) 41, 97
HphI GGTGA 1 cut(s) 92
Hpy166II GTNNAC 1 cut(s) 249
Hpy188I TCNGA 1 cut(s) 46
Hpy188III TCNNGA 1 cut(s) 170
Hpy8I GTNNAC 1 cut(s) 249
HpyAV CCTTC 1 cut(s) 152
Hsp92II CATG 1 cut(s) 122
LpnPI CCDG 4 cut(s) 22, 89, 116, 155
MaeI CTAG 2 cut(s) 33, 230
MaeIII GTNAC 1 cut(s) 144
MlsI TGGCCA 1 cut(s) 274
MluNI TGGCCA 1 cut(s) 274
MlyI GAGTC 1 cut(s) 91
MnlI CCTC 2 cut(s) 22, 87
Mox20I TGGCCA 1 cut(s) 274
MscI TGGCCA 1 cut(s) 274
MseI TTAA 3 cut(s) 53, 150, 295
MslI CAYNNNNRTG 1 cut(s) 105
Msp20I TGGCCA 1 cut(s) 274
MspR9I CCNGG 1 cut(s) 104
MvaI CCWGG 1 cut(s) 104
NlaIII CATG 1 cut(s) 122
NmuCI GTSAC 1 cut(s) 144
PfeI GAWTC 1 cut(s) 41
PleI GAGTC 1 cut(s) 91
PpsI GAGTC 1 cut(s) 91
Psp6I CCWGG 1 cut(s) 102
PspGI CCWGG 1 cut(s) 102
RsaI GTAC 1 cut(s) 248
RsaNI GTAC 1 cut(s) 247
RseI CAYNNNNRTG 1 cut(s) 105
SaqAI TTAA 3 cut(s) 53, 150, 295
SchI GAGTC 1 cut(s) 91
ScrFI CCNGG 1 cut(s) 104
SetI ASST 3 cut(s) 181, 283, 292
SmiMI CAYNNNNRTG 1 cut(s) 105
SspI AATATT 1 cut(s) 15
SspMI CTAG 2 cut(s) 33, 230
StyD4I CCNGG 1 cut(s) 102
StyI CCWWGG 1 cut(s) 72
TfiI GAWTC 1 cut(s) 41
Tru1I TTAA 3 cut(s) 53, 150, 295
Tru9I TTAA 3 cut(s) 53, 150, 295
TseFI GTSAC 1 cut(s) 144
Tsp45I GTSAC 1 cut(s) 144
XcmI CCANNNNNNNNNTGG 1 cut(s) 132
XspI CTAG 2 cut(s) 33, 230
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.