Rh1CG342300

DNA topoisomerase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0006852
Physical Location & Seq
Reverse (-)
61681241 .. 61683020
1780 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG342300.1

Sequence Viewer

Length: 153 bp
ATGAAGAAGATTCATGAGTTGAGTCTACAAGAGCGTACCATATCCAAAAGTCACACTTATCGATTAGAAACATCGAGAGAGAATTACCTTGATCCCAGGATTACTGTTGCATGGTGTCTACGACATAGGATTTCAGTTTCTAAGTTTAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Topo_C_assoc Topoisom_I Topoisom_I_N

Protein Analysis

50

Amino Acids

6.09

Weight (kDa)

10.12

Isoelectric Point (pI)

26.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Topo_C_assoc PF14370 2 - 49 1.4e-12 C-terminal topoisomerase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 25, 118
AclWI GGATC 1 cut(s) 86
AfaI GTAC 1 cut(s) 37
AjnI CCWGG 1 cut(s) 95
AlwI GGATC 1 cut(s) 86
BciT130I CCWGG 1 cut(s) 97
Bme1390I CCNGG 1 cut(s) 97
BmrFI CCNGG 1 cut(s) 97
Bsa29I ATCGAT 1 cut(s) 61
BsaJI CCNNGG 1 cut(s) 95
BseBI CCWGG 1 cut(s) 97
BseCI ATCGAT 1 cut(s) 61
BseDI CCNNGG 1 cut(s) 95
BshVI ATCGAT 1 cut(s) 61
Bsp143I GATC 1 cut(s) 91
BspDI ATCGAT 1 cut(s) 61
BspHI TCATGA 1 cut(s) 13
BspPI GGATC 1 cut(s) 86
BssECI CCNNGG 1 cut(s) 95
BssMI GATC 1 cut(s) 91
Bst2UI CCWGG 1 cut(s) 97
Bst4CI ACNGT 1 cut(s) 106
BstDEI CTNAG 1 cut(s) 141
BstKTI GATC 1 cut(s) 94
BstMBI GATC 1 cut(s) 91
BstNI CCWGG 1 cut(s) 97
BstSCI CCNGG 1 cut(s) 95
Bsu15I ATCGAT 1 cut(s) 61
BsuTUI ATCGAT 1 cut(s) 61
CciI TCATGA 1 cut(s) 13
ClaI ATCGAT 1 cut(s) 61
Csp6I GTAC 1 cut(s) 36
CviAII CATG 2 cut(s) 14, 111
CviQI GTAC 1 cut(s) 36
DdeI CTNAG 1 cut(s) 141
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
DraI TTTAAA 1 cut(s) 148
EcoRII CCWGG 1 cut(s) 95
FaeI CATG 2 cut(s) 17, 114
FaiI YATR 4 cut(s) 15, 41, 112, 126
FalI AAGNNNNNCTT 2 cut(s) 40, 72
FatI CATG 2 cut(s) 13, 110
FblI GTMKAC 2 cut(s) 25, 118
FspEI CC 8 cut(s) 52, 58, 82, 97, 101, 108, 109, 112
Hin1II CATG 2 cut(s) 17, 114
HinfI GANTC 2 cut(s) 10, 22
Hpy166II GTNNAC 2 cut(s) 26, 119
Hpy188III TCNNGA 2 cut(s) 14, 75
Hpy8I GTNNAC 2 cut(s) 26, 119
HpyCH4III ACNGT 1 cut(s) 106
HpyCH4V TGCA 1 cut(s) 110
HpyF3I CTNAG 1 cut(s) 141
Hsp92II CATG 2 cut(s) 17, 114
Kzo9I GATC 1 cut(s) 91
LpnPI CCDG 2 cut(s) 82, 109
MaeIII GTNAC 1 cut(s) 50
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MboII GAAGA 2 cut(s) 16, 19
MluCI AATT 1 cut(s) 82
MlyI GAGTC 1 cut(s) 31
MseI TTAA 1 cut(s) 147
MspR9I CCNGG 1 cut(s) 97
MvaI CCWGG 1 cut(s) 97
NdeII GATC 1 cut(s) 91
NlaIII CATG 2 cut(s) 17, 114
NmuCI GTSAC 1 cut(s) 50
PagI TCATGA 1 cut(s) 13
PfeI GAWTC 1 cut(s) 10
PleI GAGTC 1 cut(s) 30
PpsI GAGTC 1 cut(s) 30
Psp6I CCWGG 1 cut(s) 95
PspGI CCWGG 1 cut(s) 95
RsaI GTAC 1 cut(s) 37
RsaNI GTAC 1 cut(s) 36
SaqAI TTAA 1 cut(s) 147
Sau3AI GATC 1 cut(s) 91
SchI GAGTC 1 cut(s) 31
ScrFI CCNGG 1 cut(s) 97
SetI ASST 1 cut(s) 90
SgeI CNNG 7 cut(s) 26, 41, 87, 101, 108, 109, 123
Sse9I AATT 1 cut(s) 82
StyD4I CCNGG 1 cut(s) 95
TaaI ACNGT 1 cut(s) 106
TaqI TCGA 2 cut(s) 61, 74
TasI AATT 1 cut(s) 82
TfiI GAWTC 1 cut(s) 10
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TseFI GTSAC 1 cut(s) 50
Tsp45I GTSAC 1 cut(s) 50
TspDTI ATGAA 1 cut(s) 17
XmiI GTMKAC 2 cut(s) 25, 118
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.