Rh4CG248500

DNA topoisomerase 1

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
49815155 .. 49815340
186 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG248500.1

Sequence Viewer

Length: 186 bp
ATGGATGGTTTGTTGAACAAGGAAGAGTTGAAGGAGAAAACAGAAGAAGATAAGCTTGCTGTTTACTGGAATGCAAACAAGGAAGTTGCTATTTTTCTAAATCATCGGAGAGAAGTGTCAGATTTTGAAGAGAAACAAGCTTGGGAGCTTAGCATACAAATCTTTGAACTAGAGGCGCAAAAATAA

Protein Analysis

61

Amino Acids

7.33

Weight (kDa)

4.68

Isoelectric Point (pI)

46.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Topoisom_I PF01028 3 - 60 1e-07 Eukaryotic DNA topoisomerase I, catalytic core
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 4 cut(s) 16, 31, 128, 167
AluBI AGCT 3 cut(s) 55, 140, 148
AluI AGCT 3 cut(s) 55, 140, 148
AspLEI GCGC 1 cut(s) 178
BfaI CTAG 1 cut(s) 170
BlpI GCTNAGC 1 cut(s) 149
Bpu1102I GCTNAGC 1 cut(s) 149
Bse1I ACTGG 1 cut(s) 71
BseGI GGATG 1 cut(s) 10
BseNI ACTGG 1 cut(s) 71
BsmI GAATGC 1 cut(s) 76
Bsp1720I GCTNAGC 1 cut(s) 149
BsrI ACTGG 1 cut(s) 71
Bst6I CTCTTC 2 cut(s) 18, 123
BstC8I GCNNGC 1 cut(s) 57
BstDEI CTNAG 1 cut(s) 149
BstF5I GGATG 1 cut(s) 10
BstHHI GCGC 1 cut(s) 178
BtsCI GGATG 1 cut(s) 10
Cac8I GCNNGC 1 cut(s) 57
CfoI GCGC 1 cut(s) 178
CviJI RGCY 3 cut(s) 55, 140, 148
CviKI_1 RGCY 3 cut(s) 55, 140, 148
DdeI CTNAG 1 cut(s) 149
Eam1104I CTCTTC 2 cut(s) 18, 123
EarI CTCTTC 2 cut(s) 18, 123
FaiI YATR 1 cut(s) 155
FalI AAGNNNNNCTT 2 cut(s) 39, 71
FokI GGATG 1 cut(s) 17
FspBI CTAG 1 cut(s) 170
FspEI CC 8 cut(s) 5, 17, 52, 65, 91, 127, 128, 158
GlaI GCGC 1 cut(s) 177
HhaI GCGC 1 cut(s) 178
Hin6I GCGC 1 cut(s) 176
HinP1I GCGC 1 cut(s) 176
HindIII AAGCTT 2 cut(s) 53, 138
Hpy166II GTNNAC 1 cut(s) 64
Hpy188I TCNGA 2 cut(s) 108, 121
Hpy8I GTNNAC 1 cut(s) 64
HpyAV CCTTC 1 cut(s) 25
HpyCH4V TGCA 1 cut(s) 74
HpyF3I CTNAG 1 cut(s) 149
HspAI GCGC 1 cut(s) 176
LmnI GCTCC 1 cut(s) 145
LpnPI CCDG 1 cut(s) 52
MaeI CTAG 1 cut(s) 170
MboII GAAGA 4 cut(s) 35, 56, 59, 140
MnlI CCTC 1 cut(s) 166
Mva1269I GAATGC 1 cut(s) 76
PctI GAATGC 1 cut(s) 76
SetI ASST 3 cut(s) 57, 142, 150
SgeI CNNG 7 cut(s) 31, 68, 79, 91, 149, 153, 182
SspMI CTAG 1 cut(s) 170
XspI CTAG 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.