Rh2BG516300

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
72477523 .. 72477807
285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG516300.1

Sequence Viewer

Length: 285 bp
ATGCTAATAGAAGGGGTGAATCCAGATCAACTGACCTTTGTTGGGGTGTTGTCTGCATGCAGTCACAGTGGGCTGGTTGATTGGGGATTAAAATTGTTTAAGAGCATGACTCAAGTTAACCTTATTGAACCTCTAGCTGAACACTATGCTTGCATGGTAGACTTGCTTAGCCGTGCAGGGAGGTTAGAGGAAGCCTTTGAAATGGTGAGGGATATGAAGATCAAGGCAACTGCAAGAATGTGGGGTGCATTACTTGGAGCTTCCAGGATACACCGGAATCTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

94

Amino Acids

10.47

Weight (kDa)

6.82

Isoelectric Point (pI)

35.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 159
AfiI CCNNNNNNNGG 1 cut(s) 42
AgsI TTSAA 2 cut(s) 128, 200
AjnI CCWGG 1 cut(s) 263
AluBI AGCT 2 cut(s) 137, 260
AluI AGCT 2 cut(s) 137, 260
AsuHPI GGTGA 2 cut(s) 28, 217
BceAI ACGGC 1 cut(s) 156
BciT130I CCWGG 1 cut(s) 265
BciVI GTATCC 1 cut(s) 261
BfaI CTAG 1 cut(s) 134
BfmI CTRYAG 1 cut(s) 281
BfuI GTATCC 1 cut(s) 261
BlpI GCTNAGC 1 cut(s) 167
Bme1390I CCNGG 1 cut(s) 265
BmrFI CCNGG 1 cut(s) 265
BplI GAGNNNNNCTC 2 cut(s) 94, 126
Bpu1102I GCTNAGC 1 cut(s) 167
BpuEI CTTGAG 1 cut(s) 96
BsaWI WCCGGW 1 cut(s) 273
Bsc4I CCNNNNNNNGG 1 cut(s) 42
BseBI CCWGG 1 cut(s) 265
BseLI CCNNNNNNNGG 1 cut(s) 42
BsgI GTGCAG 1 cut(s) 195
BsiSI CCGG 1 cut(s) 274
BslI CCNNNNNNNGG 1 cut(s) 42
Bsp143I GATC 2 cut(s) 25, 219
Bsp1720I GCTNAGC 1 cut(s) 167
BssMI GATC 2 cut(s) 25, 219
Bst2UI CCWGG 1 cut(s) 265
Bst4CI ACNGT 1 cut(s) 68
BstC8I GCNNGC 2 cut(s) 58, 151
BstDEI CTNAG 1 cut(s) 167
BstKTI GATC 2 cut(s) 28, 222
BstMBI GATC 2 cut(s) 25, 219
BstNI CCWGG 1 cut(s) 265
BstNSI RCATGY 1 cut(s) 60
BstSCI CCNGG 1 cut(s) 263
BstSFI CTRYAG 1 cut(s) 281
BsuI GTATCC 1 cut(s) 261
BtsIMutI CAGTG 1 cut(s) 73
Cac8I GCNNGC 2 cut(s) 58, 151
CviAII CATG 3 cut(s) 57, 106, 154
CviJI RGCY 5 cut(s) 73, 137, 171, 194, 260
CviKI_1 RGCY 5 cut(s) 73, 137, 171, 194, 260
DdeI CTNAG 1 cut(s) 167
DpnI GATC 2 cut(s) 27, 221
DpnII GATC 2 cut(s) 25, 219
EcoRII CCWGG 1 cut(s) 263
FaeI CATG 3 cut(s) 60, 109, 157
FaiI YATR 6 cut(s) 58, 107, 147, 155, 215, 283
FalI AAGNNNNNCTT 2 cut(s) 105, 137
FatI CATG 3 cut(s) 56, 105, 153
FblI GTMKAC 1 cut(s) 159
FspBI CTAG 1 cut(s) 134
HapII CCGG 1 cut(s) 274
Hin1II CATG 3 cut(s) 60, 109, 157
HincII GTYRAC 1 cut(s) 118
HindII GTYRAC 1 cut(s) 118
HinfI GANTC 3 cut(s) 19, 109, 277
HpaI GTTAAC 1 cut(s) 118
HpaII CCGG 1 cut(s) 274
HphI GGTGA 2 cut(s) 28, 217
Hpy166II GTNNAC 2 cut(s) 118, 160
Hpy188III TCNNGA 1 cut(s) 23
Hpy8I GTNNAC 2 cut(s) 118, 160
HpyAV CCTTC 1 cut(s) 5
HpyCH4III ACNGT 1 cut(s) 68
HpyCH4V TGCA 6 cut(s) 56, 60, 153, 176, 233, 248
HpyF3I CTNAG 1 cut(s) 167
Hsp92II CATG 3 cut(s) 60, 109, 157
KspAI GTTAAC 1 cut(s) 118
Kzo9I GATC 2 cut(s) 25, 219
LmnI GCTCC 1 cut(s) 257
LpnPI CCDG 5 cut(s) 36, 59, 162, 250, 277
MaeI CTAG 1 cut(s) 134
MaeIII GTNAC 1 cut(s) 62
MalI GATC 2 cut(s) 27, 221
MboI GATC 2 cut(s) 25, 219
MboII GAAGA 1 cut(s) 229
MluCI AATT 1 cut(s) 92
MlyI GAGTC 1 cut(s) 103
MnlI CCTC 4 cut(s) 141, 174, 181, 201
MseI TTAA 3 cut(s) 89, 99, 117
MspI CCGG 1 cut(s) 274
MspR9I CCNGG 1 cut(s) 265
MvaI CCWGG 1 cut(s) 265
NdeII GATC 2 cut(s) 25, 219
NlaIII CATG 3 cut(s) 60, 109, 157
NmuCI GTSAC 1 cut(s) 62
NspI RCATGY 1 cut(s) 60
PaeI GCATGC 1 cut(s) 60
PfeI GAWTC 2 cut(s) 19, 277
PfoI TCCNGGA 1 cut(s) 263
PleI GAGTC 1 cut(s) 103
PpsI GAGTC 1 cut(s) 103
Psp6I CCWGG 1 cut(s) 263
PspGI CCWGG 1 cut(s) 263
SaqAI TTAA 3 cut(s) 89, 99, 117
Sau3AI GATC 2 cut(s) 25, 219
SchI GAGTC 1 cut(s) 103
ScrFI CCNGG 1 cut(s) 265
SetI ASST 6 cut(s) 38, 123, 133, 139, 185, 262
SfcI CTRYAG 1 cut(s) 281
SmlI CTYRAG 1 cut(s) 111
SmoI CTYRAG 1 cut(s) 111
SphI GCATGC 1 cut(s) 60
Sse9I AATT 1 cut(s) 92
SspMI CTAG 1 cut(s) 134
StyD4I CCNGG 1 cut(s) 263
TaaI ACNGT 1 cut(s) 68
TasI AATT 1 cut(s) 92
TfiI GAWTC 2 cut(s) 19, 277
Tru1I TTAA 3 cut(s) 89, 99, 117
Tru9I TTAA 3 cut(s) 89, 99, 117
TscAI CASTG 1 cut(s) 73
TseFI GTSAC 1 cut(s) 62
Tsp45I GTSAC 1 cut(s) 62
TspDTI ATGAA 1 cut(s) 230
TspRI CASTG 1 cut(s) 73
XceI RCATGY 1 cut(s) 60
XmiI GTMKAC 1 cut(s) 159
XspI CTAG 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.