Rh2CG245200

Calmodulin-binding transcription activator

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
25755392 .. 25765452
10061 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG245200.1

Sequence Viewer

Length: 192 bp
ATGAGGGAATTCAATCCTCTTCTTCGCTCAGTGTACCACCAGGTTTTCAAACATTTTTGCCAGAACAAGAATTGTGCAATTCAAGTGCTGAATAGTTCAGAAGGGACATCAGCTTGCATGGATGATGACCTCATAGACATTGAAGCGTTGTTCGATGATGACATTTCCTTGCCTACAGCAGCTTCATGGTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

63

Amino Acids

7.16

Weight (kDa)

4.37

Isoelectric Point (pI)

43.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 8
AfaI GTAC 1 cut(s) 35
AgsI TTSAA 4 cut(s) 13, 49, 83, 143
AjnI CCWGG 1 cut(s) 39
AluBI AGCT 2 cut(s) 113, 182
AluI AGCT 2 cut(s) 113, 182
ApeKI GCWGC 1 cut(s) 179
ApoI RAATTY 1 cut(s) 8
BciT130I CCWGG 1 cut(s) 41
BfmI CTRYAG 1 cut(s) 174
BisI GCNGC 1 cut(s) 180
BlsI GCNGC 1 cut(s) 181
Bme1390I CCNGG 1 cut(s) 41
BmrFI CCNGG 1 cut(s) 41
BseBI CCWGG 1 cut(s) 41
BseGI GGATG 1 cut(s) 127
BseMII CTCAG 1 cut(s) 42
BslFI GGGAC 1 cut(s) 118
BsmFI GGGAC 1 cut(s) 118
BspCNI CTCAG 1 cut(s) 41
Bst2UI CCWGG 1 cut(s) 41
Bst6I CTCTTC 1 cut(s) 24
BstC8I GCNNGC 1 cut(s) 115
BstDEI CTNAG 1 cut(s) 28
BstF5I GGATG 1 cut(s) 127
BstNI CCWGG 1 cut(s) 41
BstSCI CCNGG 1 cut(s) 39
BstSFI CTRYAG 1 cut(s) 174
BtsCI GGATG 1 cut(s) 127
BtsIMutI CAGTG 1 cut(s) 36
Cac8I GCNNGC 1 cut(s) 115
CsiI ACCWGGT 1 cut(s) 39
Csp6I GTAC 1 cut(s) 34
CviAII CATG 2 cut(s) 118, 186
CviJI RGCY 2 cut(s) 113, 182
CviKI_1 RGCY 2 cut(s) 113, 182
CviQI GTAC 1 cut(s) 34
DdeI CTNAG 1 cut(s) 28
Eam1104I CTCTTC 1 cut(s) 24
EarI CTCTTC 1 cut(s) 24
EcoRI GAATTC 1 cut(s) 8
EcoRII CCWGG 1 cut(s) 39
FaeI CATG 2 cut(s) 121, 189
FaiI YATR 3 cut(s) 119, 134, 187
FaqI GGGAC 1 cut(s) 118
FatI CATG 2 cut(s) 117, 185
Fnu4HI GCNGC 1 cut(s) 180
FokI GGATG 1 cut(s) 134
Fsp4HI GCNGC 1 cut(s) 180
GluI GCNGC 1 cut(s) 180
Hin1II CATG 2 cut(s) 121, 189
Hpy166II GTNNAC 1 cut(s) 34
Hpy188I TCNGA 1 cut(s) 100
Hpy8I GTNNAC 1 cut(s) 34
HpyAV CCTTC 1 cut(s) 95
HpyCH4V TGCA 2 cut(s) 77, 117
HpyF3I CTNAG 1 cut(s) 28
Hsp92II CATG 2 cut(s) 121, 189
LpnPI CCDG 3 cut(s) 26, 53, 74
MabI ACCWGGT 1 cut(s) 39
MboII GAAGA 2 cut(s) 11, 14
MluCI AATT 3 cut(s) 8, 70, 78
MnlI CCTC 2 cut(s) 27, 140
MspR9I CCNGG 1 cut(s) 41
MvaI CCWGG 1 cut(s) 41
NlaIII CATG 2 cut(s) 121, 189
PkrI GCNGC 1 cut(s) 181
Psp6I CCWGG 1 cut(s) 39
PspGI CCWGG 1 cut(s) 39
RsaI GTAC 1 cut(s) 35
RsaNI GTAC 1 cut(s) 34
SatI GCNGC 1 cut(s) 180
ScrFI CCNGG 1 cut(s) 41
SetI ASST 4 cut(s) 45, 115, 132, 184
SexAI ACCWGGT 1 cut(s) 39
SfcI CTRYAG 1 cut(s) 174
SgeI CNNG 8 cut(s) 52, 53, 73, 79, 95, 126, 130, 181
Sse9I AATT 3 cut(s) 8, 70, 78
StyD4I CCNGG 1 cut(s) 39
TaqI TCGA 1 cut(s) 153
TasI AATT 3 cut(s) 8, 70, 78
TscAI CASTG 1 cut(s) 36
TseI GCWGC 1 cut(s) 179
TspDTI ATGAA 1 cut(s) 174
TspRI CASTG 1 cut(s) 36
XapI RAATTY 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.