Rh7CG302000

Src homology 3 domains

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Reverse (-)
31377575 .. 31381988
4414 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG302000.1

Sequence Viewer

Length: 261 bp
ATGACTACACCAGTTGTTGGTTATATACGGAAGGTTGATACTGAAAGATCTTATCATGAACATGCGCTTGCCATTCTAGAGAAGCTACATTATGAGATGATTCTGGAGAAGCTACCACAAGAATTTTCATTAGAATCAGAGAAGGTGCATCCAAATGCTAGTTCAAAGAGATCCGATGATCATGAACAACTTCTCGAGATGGCAGTTTTTTCATTGCAAGAGCTATACACCCATTTGATGCTCAAGCAGATGGAGAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

10.13

Weight (kDa)

5.42

Isoelectric Point (pI)

53.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 17
AclWI GGATC 1 cut(s) 165
AcsI RAATTY 1 cut(s) 122
AfiI CCNNNNNNNGG 1 cut(s) 17
AgsI TTSAA 1 cut(s) 165
AjuI GAANNNNNNNTTGG 2 cut(s) 145, 177
AluBI AGCT 3 cut(s) 85, 112, 223
AluI AGCT 3 cut(s) 85, 112, 223
AlwI GGATC 1 cut(s) 165
Ama87I CYCGRG 1 cut(s) 194
ApoI RAATTY 1 cut(s) 122
Asp700I GAANNNNTTC 1 cut(s) 189
AspLEI GCGC 1 cut(s) 67
AvaI CYCGRG 1 cut(s) 194
BccI CCATC 2 cut(s) 193, 244
BclI TGATCA 1 cut(s) 178
BfaI CTAG 2 cut(s) 77, 159
BglII AGATCT 1 cut(s) 47
BmeT110I CYCGRG 1 cut(s) 194
BmsI GCATC 2 cut(s) 157, 228
BpmI CTGGAG 1 cut(s) 125
BpuEI CTTGAG 1 cut(s) 227
Bsc4I CCNNNNNNNGG 1 cut(s) 17
Bse1I ACTGG 1 cut(s) 11
Bse3DI GCAATG 1 cut(s) 212
BseGI GGATG 1 cut(s) 148
BseLI CCNNNNNNNGG 1 cut(s) 17
BseMI GCAATG 1 cut(s) 212
BseNI ACTGG 1 cut(s) 11
BsiHKCI CYCGRG 1 cut(s) 194
BslI CCNNNNNNNGG 1 cut(s) 17
BsoBI CYCGRG 1 cut(s) 194
Bsp143I GATC 3 cut(s) 47, 170, 178
BspHI TCATGA 2 cut(s) 55, 181
BspPI GGATC 1 cut(s) 165
BsrDI GCAATG 1 cut(s) 212
BsrI ACTGG 1 cut(s) 11
BssMI GATC 3 cut(s) 47, 170, 178
BstC8I GCNNGC 1 cut(s) 69
BstF5I GGATG 1 cut(s) 148
BstHHI GCGC 1 cut(s) 67
BstKTI GATC 3 cut(s) 50, 173, 181
BstMBI GATC 3 cut(s) 47, 170, 178
BstNSI RCATGY 1 cut(s) 65
BstX2I RGATCY 2 cut(s) 47, 170
BstYI RGATCY 2 cut(s) 47, 170
BtsCI GGATG 1 cut(s) 148
Cac8I GCNNGC 1 cut(s) 69
CciI TCATGA 2 cut(s) 55, 181
CfoI GCGC 1 cut(s) 67
CviAII CATG 3 cut(s) 56, 62, 182
CviJI RGCY 3 cut(s) 85, 112, 223
CviKI_1 RGCY 3 cut(s) 85, 112, 223
DpnI GATC 3 cut(s) 49, 172, 180
DpnII GATC 3 cut(s) 47, 170, 178
Eco88I CYCGRG 1 cut(s) 194
FaeI CATG 3 cut(s) 59, 65, 185
FaiI YATR 7 cut(s) 24, 26, 57, 63, 93, 183, 226
FatI CATG 3 cut(s) 55, 61, 181
FbaI TGATCA 1 cut(s) 178
FokI GGATG 1 cut(s) 135
FspBI CTAG 2 cut(s) 77, 159
GlaI GCGC 1 cut(s) 66
GsuI CTGGAG 1 cut(s) 125
HhaI GCGC 1 cut(s) 67
Hin1II CATG 3 cut(s) 59, 65, 185
Hin6I GCGC 1 cut(s) 65
HinP1I GCGC 1 cut(s) 65
HinfI GANTC 2 cut(s) 100, 134
Hpy188I TCNGA 2 cut(s) 139, 175
Hpy188III TCNNGA 6 cut(s) 56, 77, 104, 182, 194, 196
HpyAV CCTTC 2 cut(s) 25, 136
HpyCH4V TGCA 2 cut(s) 148, 217
Hsp92II CATG 3 cut(s) 59, 65, 185
HspAI GCGC 1 cut(s) 65
Ksp22I TGATCA 1 cut(s) 178
Kzo9I GATC 3 cut(s) 47, 170, 178
LpnPI CCDG 2 cut(s) 24, 89
LweI GCATC 2 cut(s) 157, 228
MaeI CTAG 2 cut(s) 77, 159
MalI GATC 3 cut(s) 49, 172, 180
MboI GATC 3 cut(s) 47, 170, 178
MflI RGATCY 2 cut(s) 47, 170
MluCI AATT 1 cut(s) 122
MroXI GAANNNNTTC 1 cut(s) 189
MslI CAYNNNNRTG 2 cut(s) 60, 153
NdeII GATC 3 cut(s) 47, 170, 178
NlaIII CATG 3 cut(s) 59, 65, 185
NspI RCATGY 1 cut(s) 65
PaeR7I CTCGAG 1 cut(s) 194
PagI TCATGA 2 cut(s) 55, 181
PdmI GAANNNNTTC 1 cut(s) 189
PfeI GAWTC 2 cut(s) 100, 134
PflMI CCANNNNNTGG 1 cut(s) 17
PsuI RGATCY 2 cut(s) 47, 170
RseI CAYNNNNRTG 2 cut(s) 60, 153
Sau3AI GATC 3 cut(s) 47, 170, 178
SetI ASST 5 cut(s) 36, 87, 114, 147, 225
SfaNI GCATC 2 cut(s) 157, 228
Sfr274I CTCGAG 1 cut(s) 194
SlaI CTCGAG 1 cut(s) 194
SmiMI CAYNNNNRTG 2 cut(s) 60, 153
SmlI CTYRAG 2 cut(s) 194, 242
SmoI CTYRAG 2 cut(s) 194, 242
Sse9I AATT 1 cut(s) 122
SspMI CTAG 2 cut(s) 77, 159
TaqI TCGA 1 cut(s) 195
TasI AATT 1 cut(s) 122
TfiI GAWTC 2 cut(s) 100, 134
TspDTI ATGAA 4 cut(s) 72, 117, 198, 201
TspGWI ACGGA 1 cut(s) 43
Van91I CCANNNNNTGG 1 cut(s) 17
XapI RAATTY 1 cut(s) 122
XbaI TCTAGA 1 cut(s) 76
XceI RCATGY 1 cut(s) 65
XhoI CTCGAG 1 cut(s) 194
XmnI GAANNNNTTC 1 cut(s) 189
XspI CTAG 2 cut(s) 77, 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.