Rh6DG142400

conserved protein UCP030365

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Reverse (-)
20528690 .. 20532704
4015 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG142400.1

Sequence Viewer

Length: 216 bp
ATGGGTCGGTGCCCAGATCAGATTCCAAGGTGGGTTTTGGGGGAGAAGCGGGTTGGTGTTAACTTGGGAGGTGAAGATGAACTTGGGCTTAGAAAACGGATTAAGATGCGAGATCTTGAATCAGTGTGCCGTGCTGAAGTCCGCCACATATGGATCCTGGGAACCAAAAGAAGTAGAGAAAAGATATGGGTCCGCCATCAAAAACAAGAAGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

8.4

Weight (kDa)

10.27

Isoelectric Point (pI)

65.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 9
AciI CCGC 3 cut(s) 49, 142, 193
AclWI GGATC 2 cut(s) 148, 161
AcuI CTGAAG 1 cut(s) 156
AgsI TTSAA 1 cut(s) 119
AjnI CCWGG 1 cut(s) 156
AjuI GAANNNNNNNTTGG 2 cut(s) 66, 98
AluBI AGCT 1 cut(s) 212
AluI AGCT 1 cut(s) 212
AlwI GGATC 2 cut(s) 148, 161
AspS9I GGNCC 1 cut(s) 190
AsuHPI GGTGA 1 cut(s) 83
AvaII GGWCC 1 cut(s) 190
BaeGI GKGCMC 1 cut(s) 14
BamHI GGATCC 1 cut(s) 153
BanI GGYRCC 1 cut(s) 9
BccI CCATC 1 cut(s) 204
BceAI ACGGC 1 cut(s) 114
BciT130I CCWGG 1 cut(s) 158
BglII AGATCT 1 cut(s) 112
Bme1390I CCNGG 1 cut(s) 158
Bme18I GGWCC 1 cut(s) 190
BmgT120I GGNCC 1 cut(s) 190
BmiI GGNNCC 4 cut(s) 11, 155, 163, 191
BmrFI CCNGG 1 cut(s) 158
BmsI GCATC 1 cut(s) 96
BsaJI CCNNGG 2 cut(s) 26, 157
BseBI CCWGG 1 cut(s) 158
BseDI CCNNGG 2 cut(s) 26, 157
BseSI GKGCMC 1 cut(s) 14
BshNI GGYRCC 1 cut(s) 9
Bsp1286I GDGCHC 1 cut(s) 14
Bsp143I GATC 3 cut(s) 16, 112, 153
BspACI CCGC 3 cut(s) 49, 142, 193
BspLI GGNNCC 4 cut(s) 11, 155, 163, 191
BspPI GGATC 2 cut(s) 148, 161
BspT107I GGYRCC 1 cut(s) 9
BssECI CCNNGG 2 cut(s) 26, 157
BssMI GATC 3 cut(s) 16, 112, 153
BssT1I CCWWGG 1 cut(s) 26
Bst2UI CCWGG 1 cut(s) 158
BstDEI CTNAG 1 cut(s) 89
BstKTI GATC 3 cut(s) 19, 115, 156
BstMBI GATC 3 cut(s) 16, 112, 153
BstNI CCWGG 1 cut(s) 158
BstSCI CCNGG 1 cut(s) 156
BstSLI GKGCMC 1 cut(s) 14
BstX2I RGATCY 2 cut(s) 112, 153
BstYI RGATCY 2 cut(s) 112, 153
BtsIMutI CAGTG 1 cut(s) 129
Cfr13I GGNCC 1 cut(s) 190
CviJI RGCY 2 cut(s) 88, 212
CviKI_1 RGCY 2 cut(s) 88, 212
DdeI CTNAG 1 cut(s) 89
DpnI GATC 3 cut(s) 18, 114, 155
DpnII GATC 3 cut(s) 16, 112, 153
EciI GGCGGA 2 cut(s) 131, 182
Eco130I CCWWGG 1 cut(s) 26
Eco47I GGWCC 1 cut(s) 190
Eco57I CTGAAG 1 cut(s) 156
EcoRII CCWGG 1 cut(s) 156
EcoT14I CCWWGG 1 cut(s) 26
ErhI CCWWGG 1 cut(s) 26
FaiI YATR 3 cut(s) 149, 151, 187
FalI AAGNNNNNCTT 2 cut(s) 66, 98
FauI CCCGC 1 cut(s) 42
FauNDI CATATG 1 cut(s) 149
HincII GTYRAC 1 cut(s) 61
HindII GTYRAC 1 cut(s) 61
HindIII AAGCTT 1 cut(s) 210
HinfI GANTC 2 cut(s) 22, 119
HpaI GTTAAC 1 cut(s) 61
HphI GGTGA 1 cut(s) 83
Hpy166II GTNNAC 1 cut(s) 61
Hpy188I TCNGA 1 cut(s) 21
Hpy188III TCNNGA 1 cut(s) 116
Hpy8I GTNNAC 1 cut(s) 61
HpyF3I CTNAG 1 cut(s) 89
KspAI GTTAAC 1 cut(s) 61
Kzo9I GATC 3 cut(s) 16, 112, 153
LpnPI CCDG 3 cut(s) 27, 143, 170
LweI GCATC 1 cut(s) 96
MalI GATC 3 cut(s) 18, 114, 155
MboI GATC 3 cut(s) 16, 112, 153
MboII GAAGA 1 cut(s) 86
MflI RGATCY 2 cut(s) 112, 153
MhlI GDGCHC 1 cut(s) 14
MnlI CCTC 1 cut(s) 62
MseI TTAA 3 cut(s) 60, 102, 214
MspR9I CCNGG 1 cut(s) 158
MvaI CCWGG 1 cut(s) 158
NdeI CATATG 1 cut(s) 149
NdeII GATC 3 cut(s) 16, 112, 153
NlaIV GGNNCC 4 cut(s) 11, 155, 163, 191
PfeI GAWTC 2 cut(s) 22, 119
Psp6I CCWGG 1 cut(s) 156
PspGI CCWGG 1 cut(s) 156
PspN4I GGNNCC 4 cut(s) 11, 155, 163, 191
PspPI GGNCC 1 cut(s) 190
PsuI RGATCY 2 cut(s) 112, 153
SaqAI TTAA 3 cut(s) 60, 102, 214
Sau3AI GATC 3 cut(s) 16, 112, 153
Sau96I GGNCC 1 cut(s) 190
ScrFI CCNGG 1 cut(s) 158
SduI GDGCHC 1 cut(s) 14
SetI ASST 3 cut(s) 32, 73, 214
SfaNI GCATC 1 cut(s) 96
SinI GGWCC 1 cut(s) 190
SsiI CCGC 3 cut(s) 49, 142, 193
StyD4I CCNGG 1 cut(s) 156
StyI CCWWGG 1 cut(s) 26
TfiI GAWTC 2 cut(s) 22, 119
Tru1I TTAA 3 cut(s) 60, 102, 214
Tru9I TTAA 3 cut(s) 60, 102, 214
TscAI CASTG 1 cut(s) 129
TspDTI ATGAA 1 cut(s) 93
TspGWI ACGGA 1 cut(s) 112
TspRI CASTG 1 cut(s) 129
VpaK11BI GGWCC 1 cut(s) 190
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.