Rh2CG356200

Belongs to the peptidase M16 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
48250293 .. 48263757
13465 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG356200.1

Sequence Viewer

Length: 576 bp
ATGAACTCGCGATTATATATTCGTGTGTTGGCTCAAAATCCCGAGGTTAAGTCAATGTCAGTAATCAATAGCATCTACAACAATAGTGCTTTATTTGGCATCCAAGCTTCCACTAGTTCAGATTATGTGACAGAAGCCATTGATATAGCAGCAGATGAGCTTATTGCACTTGCAACCCCTGGAGAAGTTGACCTGGTACAGCTAGATCGTGCCAAACAGTCAACGAAGTCTTCCATTCTTATGAATTTGGAATCTAGAGCATGTAAGAAGAATTTGGTTACTGTTCTTATACAGAAATTGAAGGAAATGCTTCCTCTGACATGGGTGTTGCTGAGGACTGCCGCAATACATTCTTGGAACTGCAGAGGTTGTGGAGAAGAAGAAAGAGAAAAGATCAGCCAGAGGATGAAAATTCTTCAGGATTTGGTTCCTGGATGTAATAAGATTGAGTTGAACCACACAGGCACAACCCTGATGCATAAAGTAGCCAACGGTAAAGAAAGAGCTGCTCTAGCACAATGGACAATGCTATTGCAAATTATAAGTACACAACTTCAAGTGACTGAAGGCAACTGA

Protein Analysis

191

Amino Acids

21.25

Weight (kDa)

8.35

Isoelectric Point (pI)

37.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Peptidase_M16_C PF05193 1 - 73 6e-06 Peptidase M16 inactive domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 542
AccII CGCG 1 cut(s) 10
AciI CCGC 1 cut(s) 342
AcsI RAATTY 3 cut(s) 244, 271, 411
AcuI CTGAAG 1 cut(s) 401
AfaI GTAC 2 cut(s) 198, 547
AgsI TTSAA 3 cut(s) 301, 454, 557
AhlI ACTAGT 1 cut(s) 113
AjnI CCWGG 3 cut(s) 178, 192, 430
AluBI AGCT 4 cut(s) 107, 160, 202, 506
AluI AGCT 4 cut(s) 107, 160, 202, 506
Ama87I CYCGRG 1 cut(s) 41
ApeKI GCWGC 2 cut(s) 149, 506
ApoI RAATTY 3 cut(s) 244, 271, 411
Asp700I GAANNNNTTC 1 cut(s) 309
AvaI CYCGRG 1 cut(s) 41
BbsI GAAGAC 1 cut(s) 222
BbvCI CCTCAGC 1 cut(s) 332
BbvI GCAGC 2 cut(s) 161, 493
BciT130I CCWGG 3 cut(s) 180, 194, 432
BcuI ACTAGT 1 cut(s) 113
BfaI CTAG 4 cut(s) 114, 203, 255, 512
BfmI CTRYAG 1 cut(s) 361
BisI GCNGC 3 cut(s) 150, 342, 507
BlsI GCNGC 3 cut(s) 151, 343, 508
Bme1390I CCNGG 3 cut(s) 180, 194, 432
BmeT110I CYCGRG 1 cut(s) 41
BmiI GGNNCC 1 cut(s) 429
BmrFI CCNGG 3 cut(s) 180, 194, 432
BmsI GCATC 3 cut(s) 81, 108, 465
BpiI GAAGAC 1 cut(s) 222
BpmI CTGGAG 1 cut(s) 201
Bpu10I CCTNAGC 1 cut(s) 332
BsaJI CCNNGG 2 cut(s) 42, 178
BseBI CCWGG 3 cut(s) 180, 194, 432
BseDI CCNNGG 2 cut(s) 42, 178
BseGI GGATG 3 cut(s) 99, 411, 440
BseMII CTCAG 1 cut(s) 323
BseXI GCAGC 2 cut(s) 161, 493
Bsh1236I CGCG 1 cut(s) 10
BsiHKCI CYCGRG 1 cut(s) 41
BsoBI CYCGRG 1 cut(s) 41
Bsp143I GATC 2 cut(s) 205, 393
Bsp68I TCGCGA 1 cut(s) 10
BspACI CCGC 1 cut(s) 342
BspCNI CTCAG 1 cut(s) 324
BspFNI CGCG 1 cut(s) 10
BspLI GGNNCC 1 cut(s) 429
BspMAI CTGCAG 1 cut(s) 365
BssECI CCNNGG 2 cut(s) 42, 178
BssMI GATC 2 cut(s) 205, 393
Bst2UI CCWGG 3 cut(s) 180, 194, 432
Bst4CI ACNGT 3 cut(s) 219, 283, 494
BstDEI CTNAG 1 cut(s) 332
BstF5I GGATG 3 cut(s) 99, 411, 440
BstFNI CGCG 1 cut(s) 10
BstKTI GATC 2 cut(s) 208, 396
BstMBI GATC 2 cut(s) 205, 393
BstMWI GCNNNNNNNGC 1 cut(s) 512
BstNI CCWGG 3 cut(s) 180, 194, 432
BstNSI RCATGY 1 cut(s) 264
BstSCI CCNGG 3 cut(s) 178, 192, 430
BstSFI CTRYAG 1 cut(s) 361
BstUI CGCG 1 cut(s) 10
BstV1I GCAGC 2 cut(s) 161, 493
BstV2I GAAGAC 1 cut(s) 222
BtsCI GGATG 3 cut(s) 99, 411, 440
BtuMI TCGCGA 1 cut(s) 10
CsiI ACCWGGT 1 cut(s) 192
Csp6I GTAC 2 cut(s) 197, 546
CviAII CATG 2 cut(s) 261, 321
CviJI RGCY 8 cut(s) 32, 107, 137, 160, 202, 399, 488, 506
CviKI_1 RGCY 8 cut(s) 32, 107, 137, 160, 202, 399, 488, 506
CviQI GTAC 2 cut(s) 197, 546
DdeI CTNAG 1 cut(s) 332
DpnI GATC 2 cut(s) 207, 395
DpnII GATC 2 cut(s) 205, 393
Eco57I CTGAAG 1 cut(s) 401
Eco88I CYCGRG 1 cut(s) 41
EcoRII CCWGG 3 cut(s) 178, 192, 430
EcoT22I ATGCAT 1 cut(s) 480
FaeI CATG 2 cut(s) 264, 324
FatI CATG 2 cut(s) 260, 320
Fnu4HI GCNGC 3 cut(s) 150, 342, 507
FokI GGATG 3 cut(s) 86, 418, 447
Fsp4HI GCNGC 3 cut(s) 150, 342, 507
FspBI CTAG 4 cut(s) 114, 203, 255, 512
GluI GCNGC 3 cut(s) 150, 342, 507
GsuI CTGGAG 1 cut(s) 201
Hin1II CATG 2 cut(s) 264, 324
HincII GTYRAC 2 cut(s) 190, 222
HindII GTYRAC 2 cut(s) 190, 222
HindIII AAGCTT 1 cut(s) 105
HinfI GANTC 1 cut(s) 251
Hpy166II GTNNAC 3 cut(s) 190, 222, 548
Hpy188I TCNGA 2 cut(s) 121, 318
Hpy188III TCNNGA 4 cut(s) 9, 41, 255, 419
Hpy8I GTNNAC 3 cut(s) 190, 222, 548
HpyAV CCTTC 2 cut(s) 295, 560
HpyCH4III ACNGT 3 cut(s) 219, 283, 494
HpyCH4V TGCA 5 cut(s) 167, 173, 363, 478, 535
HpyF10VI GCNNNNNNNGC 1 cut(s) 512
HpyF3I CTNAG 1 cut(s) 332
Hsp92II CATG 2 cut(s) 264, 324
Kzo9I GATC 2 cut(s) 205, 393
Lsp1109I GCAGC 2 cut(s) 161, 493
LweI GCATC 3 cut(s) 81, 108, 465
MabI ACCWGGT 1 cut(s) 192
MaeI CTAG 4 cut(s) 114, 203, 255, 512
MaeIII GTNAC 3 cut(s) 127, 277, 559
MalI GATC 2 cut(s) 207, 395
MboI GATC 2 cut(s) 205, 393
MboII GAAGA 5 cut(s) 222, 280, 389, 392, 407
MluCI AATT 5 cut(s) 244, 271, 296, 411, 537
MnlI CCTC 5 cut(s) 37, 324, 327, 359, 396
Mph1103I ATGCAT 1 cut(s) 480
MroXI GAANNNNTTC 1 cut(s) 309
MseI TTAA 1 cut(s) 48
MslI CAYNNNNRTG 1 cut(s) 239
MspR9I CCNGG 3 cut(s) 180, 194, 432
MvaI CCWGG 3 cut(s) 180, 194, 432
MvnI CGCG 1 cut(s) 10
MwoI GCNNNNNNNGC 1 cut(s) 512
NdeII GATC 2 cut(s) 205, 393
NlaIII CATG 2 cut(s) 264, 324
NlaIV GGNNCC 1 cut(s) 429
NmuCI GTSAC 2 cut(s) 127, 559
NruI TCGCGA 1 cut(s) 10
NsiI ATGCAT 1 cut(s) 480
NspI RCATGY 1 cut(s) 264
PdmI GAANNNNTTC 1 cut(s) 309
PfeI GAWTC 1 cut(s) 251
PfoI TCCNGGA 1 cut(s) 430
PkrI GCNGC 3 cut(s) 151, 343, 508
PsiI TTATAA 1 cut(s) 542
Psp6I CCWGG 3 cut(s) 178, 192, 430
PspGI CCWGG 3 cut(s) 178, 192, 430
PspN4I GGNNCC 1 cut(s) 429
PstI CTGCAG 1 cut(s) 365
RruI TCGCGA 1 cut(s) 10
RsaI GTAC 2 cut(s) 198, 547
RsaNI GTAC 2 cut(s) 197, 546
RseI CAYNNNNRTG 1 cut(s) 239
SaqAI TTAA 1 cut(s) 48
SatI GCNGC 3 cut(s) 150, 342, 507
Sau3AI GATC 2 cut(s) 205, 393
ScrFI CCNGG 3 cut(s) 180, 194, 432
SetI ASST 7 cut(s) 48, 109, 162, 195, 204, 370, 508
SexAI ACCWGGT 1 cut(s) 192
SfaNI GCATC 3 cut(s) 81, 108, 465
SfcI CTRYAG 1 cut(s) 361
SmiMI CAYNNNNRTG 1 cut(s) 239
SpeI ACTAGT 1 cut(s) 113
Sse9I AATT 5 cut(s) 244, 271, 296, 411, 537
SsiI CCGC 1 cut(s) 342
SspMI CTAG 4 cut(s) 114, 203, 255, 512
StyD4I CCNGG 3 cut(s) 178, 192, 430
TaaI ACNGT 3 cut(s) 219, 283, 494
TasI AATT 5 cut(s) 244, 271, 296, 411, 537
TatI WGTACW 1 cut(s) 545
TauI GCSGC 1 cut(s) 344
TfiI GAWTC 1 cut(s) 251
Tru1I TTAA 1 cut(s) 48
Tru9I TTAA 1 cut(s) 48
TseFI GTSAC 2 cut(s) 127, 559
TseI GCWGC 2 cut(s) 149, 506
Tsp45I GTSAC 2 cut(s) 127, 559
TspDTI ATGAA 3 cut(s) 17, 257, 422
XapI RAATTY 3 cut(s) 244, 271, 411
XbaI TCTAGA 1 cut(s) 254
XceI RCATGY 1 cut(s) 264
XmnI GAANNNNTTC 1 cut(s) 309
XspI CTAG 4 cut(s) 114, 203, 255, 512
Zsp2I ATGCAT 1 cut(s) 480
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.