Rh3AG317100

Transmembrane protein 230-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Reverse (-)
43442377 .. 43442595
219 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG317100.1

Sequence Viewer

Length: 219 bp
ATGGCATATATAGATCACCCATTCTCGATTGCCGATGTAGACATAATGATGGAGATCTCCTACACTGTCAACAACAAGCCTCCAATCAAAGAGATTGCTGTCGACATCGCAGTCACCGAAACCCTCGACATTGTCGTCGGCACCCTCATGGCCTATAACCTTATCGGCGGAGACAAAGCTCACAGTACCCTAATGCCACCCTTCTACTGCCCTTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

7.98

Weight (kDa)

4.3

Isoelectric Point (pI)

33.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 2 cut(s) 110, 134
AccB1I GGYRCC 1 cut(s) 140
AccI GTMKAC 2 cut(s) 39, 102
AciI CCGC 1 cut(s) 168
AfaI GTAC 1 cut(s) 187
AluBI AGCT 1 cut(s) 179
AluI AGCT 1 cut(s) 179
Alw26I GTCTC 1 cut(s) 165
AoxI GGCC 1 cut(s) 150
AsuHPI GGTGA 2 cut(s) 8, 106
BanI GGYRCC 1 cut(s) 140
BccI CCATC 1 cut(s) 43
BcoDI GTCTC 1 cut(s) 165
BglII AGATCT 1 cut(s) 54
BmiI GGNNCC 1 cut(s) 142
BsaBI GATNNNNATC 1 cut(s) 53
Bse8I GATNNNNATC 1 cut(s) 53
BseJI GATNNNNATC 1 cut(s) 53
BshFI GGCC 1 cut(s) 152
BshNI GGYRCC 1 cut(s) 140
BsmAI GTCTC 1 cut(s) 165
BsnI GGCC 1 cut(s) 152
Bsp143I GATC 2 cut(s) 13, 54
BspACI CCGC 1 cut(s) 168
BspANI GGCC 1 cut(s) 152
BspLI GGNNCC 1 cut(s) 142
BspT107I GGYRCC 1 cut(s) 140
BssMI GATC 2 cut(s) 13, 54
Bst4CI ACNGT 2 cut(s) 67, 185
BstKTI GATC 2 cut(s) 16, 57
BstMAI GTCTC 1 cut(s) 165
BstMBI GATC 2 cut(s) 13, 54
BstX2I RGATCY 1 cut(s) 54
BstYI RGATCY 1 cut(s) 54
BsuRI GGCC 1 cut(s) 152
BtgZI GCGATG 1 cut(s) 91
BtsIMutI CAGTG 1 cut(s) 63
Csp6I GTAC 1 cut(s) 186
CviAII CATG 1 cut(s) 148
CviJI RGCY 3 cut(s) 79, 152, 179
CviKI_1 RGCY 3 cut(s) 79, 152, 179
CviQI GTAC 1 cut(s) 186
DpnI GATC 2 cut(s) 15, 56
DpnII GATC 2 cut(s) 13, 54
DrdI GACNNNNNNGTC 2 cut(s) 110, 134
DseDI GACNNNNNNGTC 2 cut(s) 110, 134
EciI GGCGGA 1 cut(s) 183
FaeI CATG 1 cut(s) 151
FaiI YATR 6 cut(s) 7, 9, 11, 44, 149, 156
FatI CATG 1 cut(s) 147
FblI GTMKAC 2 cut(s) 39, 102
HaeIII GGCC 1 cut(s) 152
Hin1II CATG 1 cut(s) 151
HincII GTYRAC 2 cut(s) 70, 103
HindII GTYRAC 2 cut(s) 70, 103
HphI GGTGA 2 cut(s) 8, 106
Hpy166II GTNNAC 3 cut(s) 40, 70, 103
Hpy188III TCNNGA 1 cut(s) 25
Hpy8I GTNNAC 3 cut(s) 40, 70, 103
Hpy99I CGWCG 1 cut(s) 140
HpyAV CCTTC 1 cut(s) 211
HpyCH4III ACNGT 2 cut(s) 67, 185
Hsp92II CATG 1 cut(s) 151
Kzo9I GATC 2 cut(s) 13, 54
MaeIII GTNAC 1 cut(s) 112
MalI GATC 2 cut(s) 15, 56
MboI GATC 2 cut(s) 13, 54
MflI RGATCY 1 cut(s) 54
MnlI CCTC 3 cut(s) 90, 134, 155
MslI CAYNNNNRTG 2 cut(s) 47, 146
NdeII GATC 2 cut(s) 13, 54
NlaIII CATG 1 cut(s) 151
NlaIV GGNNCC 1 cut(s) 142
NmuCI GTSAC 1 cut(s) 112
PcsI WCGNNNNNNNCGW 2 cut(s) 114, 132
PflFI GACNNNGTC 1 cut(s) 131
PspN4I GGNNCC 1 cut(s) 142
PsuI RGATCY 1 cut(s) 54
PsyI GACNNNGTC 1 cut(s) 131
RsaI GTAC 1 cut(s) 187
RsaNI GTAC 1 cut(s) 186
RseI CAYNNNNRTG 2 cut(s) 47, 146
SalI GTCGAC 1 cut(s) 101
Sau3AI GATC 2 cut(s) 13, 54
SetI ASST 2 cut(s) 162, 181
SgeI CNNG 4 cut(s) 37, 88, 137, 160
SmiMI CAYNNNNRTG 2 cut(s) 47, 146
SsiI CCGC 1 cut(s) 168
TaaI ACNGT 2 cut(s) 67, 185
TaqI TCGA 3 cut(s) 26, 102, 126
TscAI CASTG 1 cut(s) 70
TseFI GTSAC 1 cut(s) 112
Tsp45I GTSAC 1 cut(s) 112
TspRI CASTG 1 cut(s) 70
Tth111I GACNNNGTC 1 cut(s) 131
XmiI GTMKAC 2 cut(s) 39, 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.