Rh3DG331500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Forward (+)
36761784 .. 36766451
4668 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG331500.1

Sequence Viewer

Length: 177 bp
ATGAAGTGCGGAGTCAAACTATTCCGAATAGCCCAGTTGATGCATCTGAACACAATACAGGTAATTGATTCGAAGAAGATGGACTACACTTTTGCAATTAGAAGAAGGCTATATCTGCTTCCTGATAACCTAGCAAAGGTAAGTACGATCTGCATGTTGTTCATTGCATTTGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.77

Weight (kDa)

9.92

Isoelectric Point (pI)

50.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 9
AfaI GTAC 1 cut(s) 145
AfiI CCNNNNNNNGG 1 cut(s) 136
ArsI GACNNNNNNTTYG 2 cut(s) 74, 106
AsuII TTCGAA 1 cut(s) 71
BarI GAAGNNNNNNTAC 2 cut(s) 68, 100
BccI CCATC 1 cut(s) 73
BfaI CTAG 1 cut(s) 131
BmrI ACTGGG 1 cut(s) 28
BmsI GCATC 2 cut(s) 30, 52
BmuI ACTGGG 1 cut(s) 28
Bpu14I TTCGAA 1 cut(s) 71
Bsc4I CCNNNNNNNGG 1 cut(s) 136
Bse1I ACTGG 1 cut(s) 34
Bse3DI GCAATG 1 cut(s) 162
BseLI CCNNNNNNNGG 1 cut(s) 136
BseMI GCAATG 1 cut(s) 162
BseNI ACTGG 1 cut(s) 34
BslI CCNNNNNNNGG 1 cut(s) 136
Bsp119I TTCGAA 1 cut(s) 71
Bsp143I GATC 1 cut(s) 147
BspACI CCGC 1 cut(s) 9
BspT104I TTCGAA 1 cut(s) 71
BsrDI GCAATG 1 cut(s) 162
BsrI ACTGG 1 cut(s) 34
BssMI GATC 1 cut(s) 147
BstBI TTCGAA 1 cut(s) 71
BstDEI CTNAG 1 cut(s) 174
BstENI CCTNNNNNAGG 1 cut(s) 134
BstKTI GATC 1 cut(s) 150
BstMBI GATC 1 cut(s) 147
BstMWI GCNNNNNNNGC 1 cut(s) 115
BstNSI RCATGY 1 cut(s) 157
Csp6I GTAC 1 cut(s) 144
CviAII CATG 1 cut(s) 154
CviJI RGCY 2 cut(s) 32, 109
CviKI_1 RGCY 2 cut(s) 32, 109
CviQI GTAC 1 cut(s) 144
DdeI CTNAG 1 cut(s) 174
DpnI GATC 1 cut(s) 149
DpnII GATC 1 cut(s) 147
EcoNI CCTNNNNNAGG 1 cut(s) 134
EcoT22I ATGCAT 1 cut(s) 45
FaeI CATG 1 cut(s) 157
FaiI YATR 2 cut(s) 112, 155
FatI CATG 1 cut(s) 153
FspBI CTAG 1 cut(s) 131
FspEI CC 9 cut(s) 38, 44, 46, 47, 65, 91, 122, 135, 143
Hin1II CATG 1 cut(s) 157
HinfI GANTC 2 cut(s) 12, 68
Hpy188I TCNGA 2 cut(s) 26, 48
Hpy188III TCNNGA 1 cut(s) 122
HpyAV CCTTC 1 cut(s) 99
HpyCH4V TGCA 4 cut(s) 43, 95, 153, 167
HpyF10VI GCNNNNNNNGC 1 cut(s) 115
HpyF3I CTNAG 1 cut(s) 174
Hsp92II CATG 1 cut(s) 157
Kzo9I GATC 1 cut(s) 147
LpnPI CCDG 3 cut(s) 44, 47, 135
LweI GCATC 2 cut(s) 30, 52
MaeI CTAG 1 cut(s) 131
MalI GATC 1 cut(s) 149
MboI GATC 1 cut(s) 147
MboII GAAGA 3 cut(s) 85, 88, 114
MluCI AATT 2 cut(s) 63, 96
MlyI GAGTC 1 cut(s) 21
Mph1103I ATGCAT 1 cut(s) 45
MwoI GCNNNNNNNGC 1 cut(s) 115
NdeII GATC 1 cut(s) 147
NlaIII CATG 1 cut(s) 157
NsiI ATGCAT 1 cut(s) 45
NspI RCATGY 1 cut(s) 157
NspV TTCGAA 1 cut(s) 71
PfeI GAWTC 1 cut(s) 68
PleI GAGTC 1 cut(s) 20
PpsI GAGTC 1 cut(s) 20
RsaI GTAC 1 cut(s) 145
RsaNI GTAC 1 cut(s) 144
Sau3AI GATC 1 cut(s) 147
SchI GAGTC 1 cut(s) 21
SetI ASST 3 cut(s) 63, 132, 141
SfaNI GCATC 2 cut(s) 30, 52
SfuI TTCGAA 1 cut(s) 71
SgeI CNNG 5 cut(s) 46, 71, 134, 143, 166
Sse9I AATT 2 cut(s) 63, 96
SsiI CCGC 1 cut(s) 9
SspMI CTAG 1 cut(s) 131
TaqI TCGA 1 cut(s) 71
TasI AATT 2 cut(s) 63, 96
TfiI GAWTC 1 cut(s) 68
TspDTI ATGAA 2 cut(s) 17, 151
XagI CCTNNNNNAGG 1 cut(s) 134
XceI RCATGY 1 cut(s) 157
XspI CTAG 1 cut(s) 131
Zsp2I ATGCAT 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.