Rh6AG232700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0011603
Physical Location & Seq
Forward (+)
41657940 .. 41682938
24999 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG232700.1

Sequence Viewer

Length: 333 bp
ATGGAGGATAAATGCAAGAAGAATTCAACTAGCCGAAAGAGACAAAGGAGTACGCATCGTGGCGGAGCTATGCCTTTCATTCAACATGCTTTGAGGACAGCCAAGGCCTGTTGGTATAGGAGGAGACCAGCCCCACAAAATATGAATAAACCTTCCATAAGCTATAAATTAAAGGGTGAGCCAAGCCTTGCGGTAGTGAAAGGCCAGGATCACATGCGTAAGCCCCATTGCGCCCCAATAGCAGGCTACTGTGAAATTGAATGTTGTGATCCAAGATCAACTGATGTGATTGATGCAAGCCTGCAACTTTACTTGATCGACGTAATTCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

110

Amino Acids

12.5

Weight (kDa)

9.62

Isoelectric Point (pI)

72.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 63, 191
AclWI GGATC 2 cut(s) 216, 263
AcsI RAATTY 1 cut(s) 22
AfaI GTAC 1 cut(s) 52
AfiI CCNNNNNNNGG 1 cut(s) 242
AgsI TTSAA 3 cut(s) 27, 83, 260
AjnI CCWGG 1 cut(s) 204
AluBI AGCT 2 cut(s) 68, 162
AluI AGCT 2 cut(s) 68, 162
Alw26I GTCTC 2 cut(s) 34, 118
AlwI GGATC 2 cut(s) 216, 263
AoxI GGCC 2 cut(s) 105, 202
ApoI RAATTY 1 cut(s) 22
AspLEI GCGC 1 cut(s) 233
AsuHPI GGTGA 1 cut(s) 188
BciT130I CCWGG 1 cut(s) 206
BcoDI GTCTC 2 cut(s) 34, 118
BfaI CTAG 1 cut(s) 30
Bme1390I CCNGG 1 cut(s) 206
BmrFI CCNGG 1 cut(s) 206
BmsI GCATC 2 cut(s) 64, 283
BsaI GGTCTC 1 cut(s) 118
BsaJI CCNNGG 1 cut(s) 102
Bsc4I CCNNNNNNNGG 1 cut(s) 242
Bse3DI GCAATG 1 cut(s) 226
BseBI CCWGG 1 cut(s) 206
BseDI CCNNGG 1 cut(s) 102
BseLI CCNNNNNNNGG 1 cut(s) 242
BseMI GCAATG 1 cut(s) 226
BseRI GAGGAG 1 cut(s) 136
BshFI GGCC 2 cut(s) 107, 204
BslI CCNNNNNNNGG 1 cut(s) 242
BsmAI GTCTC 2 cut(s) 34, 118
BsnI GGCC 2 cut(s) 107, 204
Bso31I GGTCTC 1 cut(s) 118
Bsp143I GATC 4 cut(s) 208, 268, 275, 315
BspACI CCGC 2 cut(s) 63, 191
BspANI GGCC 2 cut(s) 107, 204
BspPI GGATC 2 cut(s) 216, 263
BspTNI GGTCTC 1 cut(s) 118
BsrDI GCAATG 1 cut(s) 226
BssECI CCNNGG 1 cut(s) 102
BssMI GATC 4 cut(s) 208, 268, 275, 315
BssT1I CCWWGG 1 cut(s) 102
Bst2UI CCWGG 1 cut(s) 206
Bst4CI ACNGT 1 cut(s) 251
BstC8I GCNNGC 3 cut(s) 244, 298, 302
BstHHI GCGC 1 cut(s) 233
BstKTI GATC 4 cut(s) 211, 271, 278, 318
BstMAI GTCTC 2 cut(s) 34, 118
BstMBI GATC 4 cut(s) 208, 268, 275, 315
BstMWI GCNNNNNNNGC 1 cut(s) 239
BstNI CCWGG 1 cut(s) 206
BstNSI RCATGY 2 cut(s) 89, 217
BstSCI CCNGG 1 cut(s) 204
BsuRI GGCC 2 cut(s) 107, 204
Cac8I GCNNGC 3 cut(s) 244, 298, 302
CfoI GCGC 1 cut(s) 233
Csp6I GTAC 1 cut(s) 51
CviAII CATG 2 cut(s) 86, 214
CviQI GTAC 1 cut(s) 51
DpnI GATC 4 cut(s) 210, 270, 277, 317
DpnII GATC 4 cut(s) 208, 268, 275, 315
EciI GGCGGA 1 cut(s) 78
Eco130I CCWWGG 1 cut(s) 102
Eco147I AGGCCT 1 cut(s) 107
Eco31I GGTCTC 1 cut(s) 118
EcoRI GAATTC 1 cut(s) 22
EcoRII CCWGG 1 cut(s) 204
EcoT14I CCWWGG 1 cut(s) 102
ErhI CCWWGG 1 cut(s) 102
FaeI CATG 2 cut(s) 89, 217
FaiI YATR 7 cut(s) 71, 87, 117, 143, 158, 165, 215
FatI CATG 2 cut(s) 85, 213
FspBI CTAG 1 cut(s) 30
GlaI GCGC 1 cut(s) 232
HaeIII GGCC 2 cut(s) 107, 204
HhaI GCGC 1 cut(s) 233
Hin1II CATG 2 cut(s) 89, 217
Hin6I GCGC 1 cut(s) 231
HinP1I GCGC 1 cut(s) 231
HphI GGTGA 1 cut(s) 188
Hpy99I CGWCG 1 cut(s) 323
HpyAV CCTTC 1 cut(s) 162
HpyCH4III ACNGT 1 cut(s) 251
HpyCH4IV ACGT 1 cut(s) 321
HpyCH4V TGCA 3 cut(s) 15, 296, 304
HpyF10VI GCNNNNNNNGC 1 cut(s) 239
HpySE526I ACGT 1 cut(s) 321
Hsp92II CATG 2 cut(s) 89, 217
HspAI GCGC 1 cut(s) 231
Kzo9I GATC 4 cut(s) 208, 268, 275, 315
LmnI GCTCC 1 cut(s) 65
LpnPI CCDG 6 cut(s) 121, 141, 191, 218, 228, 314
LweI GCATC 2 cut(s) 64, 283
MaeI CTAG 1 cut(s) 30
MaeII ACGT 1 cut(s) 321
MalI GATC 4 cut(s) 210, 270, 277, 317
MboI GATC 4 cut(s) 208, 268, 275, 315
MboII GAAGA 1 cut(s) 31
MluCI AATT 4 cut(s) 22, 167, 255, 324
MnlI CCTC 2 cut(s) 87, 114
MseI TTAA 1 cut(s) 170
MspR9I CCNGG 1 cut(s) 206
MvaI CCWGG 1 cut(s) 206
MwoI GCNNNNNNNGC 1 cut(s) 239
NdeII GATC 4 cut(s) 208, 268, 275, 315
NlaIII CATG 2 cut(s) 89, 217
NspI RCATGY 2 cut(s) 89, 217
PceI AGGCCT 1 cut(s) 107
Psp6I CCWGG 1 cut(s) 204
PspGI CCWGG 1 cut(s) 204
RsaI GTAC 1 cut(s) 52
RsaNI GTAC 1 cut(s) 51
SaqAI TTAA 1 cut(s) 170
Sau3AI GATC 4 cut(s) 208, 268, 275, 315
ScrFI CCNGG 1 cut(s) 206
SetI ASST 4 cut(s) 70, 154, 164, 324
SfaNI GCATC 2 cut(s) 64, 283
Sse9I AATT 4 cut(s) 22, 167, 255, 324
SseBI AGGCCT 1 cut(s) 107
SsiI CCGC 2 cut(s) 63, 191
SspMI CTAG 1 cut(s) 30
StuI AGGCCT 1 cut(s) 107
StyD4I CCNGG 1 cut(s) 204
StyI CCWWGG 1 cut(s) 102
TaaI ACNGT 1 cut(s) 251
TaiI ACGT 1 cut(s) 324
TaqI TCGA 1 cut(s) 318
TasI AATT 4 cut(s) 22, 167, 255, 324
Tru1I TTAA 1 cut(s) 170
Tru9I TTAA 1 cut(s) 170
TspDTI ATGAA 2 cut(s) 67, 158
XapI RAATTY 1 cut(s) 22
XceI RCATGY 2 cut(s) 89, 217
XspI CTAG 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.