Rh5DG469700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
74486815 .. 74494146
7332 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG469700.1

Sequence Viewer

Length: 183 bp
ATGAAGTGCGGAGTCAAACTATTCCGAATAGCCCAGTTGATGCATCTGAACGCAATACAGGATAAATGCAAGAAGAATTCAACTAGCCGAAAGAGACAAAGGAGTACGCATCGTGGCGGAGCTATGCCTTTCATTCAACATGCTTTGAGGACAGCCAAGGTAAATTTTATGAGTTTCGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

6.95

Weight (kDa)

11.43

Isoelectric Point (pI)

54.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 9, 117
AcsI RAATTY 2 cut(s) 76, 163
AfaI GTAC 1 cut(s) 106
AgsI TTSAA 2 cut(s) 81, 137
AluBI AGCT 1 cut(s) 122
AluI AGCT 1 cut(s) 122
Alw26I GTCTC 1 cut(s) 88
ApoI RAATTY 2 cut(s) 76, 163
BcoDI GTCTC 1 cut(s) 88
BfaI CTAG 1 cut(s) 84
BmrI ACTGGG 1 cut(s) 28
BmsI GCATC 3 cut(s) 30, 52, 118
BmuI ACTGGG 1 cut(s) 28
BsaJI CCNNGG 1 cut(s) 156
Bse1I ACTGG 1 cut(s) 34
BseDI CCNNGG 1 cut(s) 156
BseNI ACTGG 1 cut(s) 34
BsmAI GTCTC 1 cut(s) 88
BspACI CCGC 2 cut(s) 9, 117
BsrI ACTGG 1 cut(s) 34
BssECI CCNNGG 1 cut(s) 156
BssT1I CCWWGG 1 cut(s) 156
BstMAI GTCTC 1 cut(s) 88
BstNSI RCATGY 1 cut(s) 143
Csp6I GTAC 1 cut(s) 105
CviAII CATG 1 cut(s) 140
CviJI RGCY 4 cut(s) 32, 87, 122, 155
CviKI_1 RGCY 4 cut(s) 32, 87, 122, 155
CviQI GTAC 1 cut(s) 105
EciI GGCGGA 1 cut(s) 132
Eco130I CCWWGG 1 cut(s) 156
EcoRI GAATTC 1 cut(s) 76
EcoT14I CCWWGG 1 cut(s) 156
EcoT22I ATGCAT 1 cut(s) 45
ErhI CCWWGG 1 cut(s) 156
FaeI CATG 1 cut(s) 143
FaiI YATR 3 cut(s) 125, 141, 170
FatI CATG 1 cut(s) 139
FspBI CTAG 1 cut(s) 84
Hin1II CATG 1 cut(s) 143
HinfI GANTC 1 cut(s) 12
Hpy188I TCNGA 2 cut(s) 26, 48
HpyCH4V TGCA 2 cut(s) 43, 69
Hsp92II CATG 1 cut(s) 143
LmnI GCTCC 1 cut(s) 119
LpnPI CCDG 2 cut(s) 44, 47
LweI GCATC 3 cut(s) 30, 52, 118
MaeI CTAG 1 cut(s) 84
MboII GAAGA 1 cut(s) 85
MluCI AATT 2 cut(s) 76, 163
MlyI GAGTC 1 cut(s) 21
MnlI CCTC 1 cut(s) 141
Mph1103I ATGCAT 1 cut(s) 45
NlaIII CATG 1 cut(s) 143
NsiI ATGCAT 1 cut(s) 45
NspI RCATGY 1 cut(s) 143
PleI GAGTC 1 cut(s) 20
PpsI GAGTC 1 cut(s) 20
RsaI GTAC 1 cut(s) 106
RsaNI GTAC 1 cut(s) 105
SchI GAGTC 1 cut(s) 21
SetI ASST 2 cut(s) 124, 162
SfaNI GCATC 3 cut(s) 30, 52, 118
SgeI CNNG 7 cut(s) 46, 71, 82, 96, 125, 152, 169
Sse9I AATT 2 cut(s) 76, 163
SsiI CCGC 2 cut(s) 9, 117
SspMI CTAG 1 cut(s) 84
StyI CCWWGG 1 cut(s) 156
TaqI TCGA 1 cut(s) 177
TasI AATT 2 cut(s) 76, 163
TspDTI ATGAA 2 cut(s) 17, 121
XapI RAATTY 2 cut(s) 76, 163
XceI RCATGY 1 cut(s) 143
XspI CTAG 1 cut(s) 84
Zsp2I ATGCAT 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.