Rh4BG175800

F-box protein At3g07870-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Reverse (-)
31241440 .. 31241739
300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG175800.1

Sequence Viewer

Length: 300 bp
ATGAAGACAACCGAACTGAACCACGGAGACCCGCCAGATAGATCCCGTAACCAAAATGACGACAAAAAACAAACAGAGCCCGAAATTGATCACAAATCCAACCTTCTTGAATTACCTGATCACATAACACTTGACATCGTCCGCAGAATCCCAATGAAGACGCTGATGAGATGCAGATGTGTGTGCAATTCTTGGCGGTGTTTGTTCTCAGACCCCAAATTCACCAAAGATCTATTTGCTCGCACACTCCCTTGCCATTTGGTCCATGTCAAAGGTTCAGACAGGTTTTTTCTTGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

11.63

Weight (kDa)

8.69

Isoelectric Point (pI)

42.09

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box PF00646 35 - 76 7.6e-10 F-box domain
F-box-like PF12937 36 - 79 8.7e-09 F-box-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 32, 142, 196
AclWI GGATC 1 cut(s) 36
AcsI RAATTY 1 cut(s) 218
AgsI TTSAA 1 cut(s) 110
Alw26I GTCTC 1 cut(s) 21
AlwI GGATC 1 cut(s) 36
ApoI RAATTY 1 cut(s) 218
AspS9I GGNCC 1 cut(s) 262
AsuHPI GGTGA 1 cut(s) 214
AvaII GGWCC 1 cut(s) 262
BanII GRGCYC 1 cut(s) 81
BbsI GAAGAC 2 cut(s) 11, 164
BclI TGATCA 2 cut(s) 88, 118
BcoDI GTCTC 1 cut(s) 21
BglII AGATCT 1 cut(s) 229
Bme18I GGWCC 1 cut(s) 262
BmgT120I GGNCC 1 cut(s) 262
BmsI GCATC 1 cut(s) 161
BpiI GAAGAC 2 cut(s) 11, 164
BsaI GGTCTC 1 cut(s) 21
BsaJI CCNNGG 1 cut(s) 22
BseDI CCNNGG 1 cut(s) 22
BseMII CTCAG 1 cut(s) 222
BsmAI GTCTC 1 cut(s) 21
Bso31I GGTCTC 1 cut(s) 21
Bsp1286I GDGCHC 1 cut(s) 81
Bsp143I GATC 4 cut(s) 41, 88, 118, 229
BspACI CCGC 3 cut(s) 32, 142, 196
BspCNI CTCAG 1 cut(s) 221
BspPI GGATC 1 cut(s) 36
BspTNI GGTCTC 1 cut(s) 21
BssECI CCNNGG 1 cut(s) 22
BssMI GATC 4 cut(s) 41, 88, 118, 229
BstC8I GCNNGC 1 cut(s) 241
BstDEI CTNAG 1 cut(s) 208
BstDSI CCRYGG 1 cut(s) 22
BstKTI GATC 4 cut(s) 44, 91, 121, 232
BstMAI GTCTC 1 cut(s) 21
BstMBI GATC 4 cut(s) 41, 88, 118, 229
BstV2I GAAGAC 2 cut(s) 11, 164
BstX2I RGATCY 2 cut(s) 41, 229
BstYI RGATCY 2 cut(s) 41, 229
BtgI CCRYGG 1 cut(s) 22
Cac8I GCNNGC 1 cut(s) 241
Cfr13I GGNCC 1 cut(s) 262
CseI GACGC 1 cut(s) 169
CviAII CATG 1 cut(s) 266
CviJI RGCY 1 cut(s) 79
CviKI_1 RGCY 1 cut(s) 79
DdeI CTNAG 1 cut(s) 208
DpnI GATC 4 cut(s) 43, 90, 120, 231
DpnII GATC 4 cut(s) 41, 88, 118, 229
Eco24I GRGCYC 1 cut(s) 81
Eco31I GGTCTC 1 cut(s) 21
Eco47I GGWCC 1 cut(s) 262
EcoT38I GRGCYC 1 cut(s) 81
FaeI CATG 1 cut(s) 269
FaiI YATR 2 cut(s) 125, 267
FatI CATG 1 cut(s) 265
FauI CCCGC 1 cut(s) 39
FbaI TGATCA 2 cut(s) 88, 118
FriOI GRGCYC 1 cut(s) 81
HgaI GACGC 1 cut(s) 169
Hin1II CATG 1 cut(s) 269
HinfI GANTC 1 cut(s) 147
HphI GGTGA 1 cut(s) 214
Hpy188I TCNGA 2 cut(s) 211, 280
Hpy188III TCNNGA 1 cut(s) 107
HpyAV CCTTC 1 cut(s) 113
HpyCH4V TGCA 2 cut(s) 174, 186
HpyF3I CTNAG 1 cut(s) 208
Hsp92II CATG 1 cut(s) 269
Ksp22I TGATCA 2 cut(s) 88, 118
Kzo9I GATC 4 cut(s) 41, 88, 118, 229
LpnPI CCDG 3 cut(s) 48, 129, 268
LweI GCATC 1 cut(s) 161
MaeIII GTNAC 1 cut(s) 47
MalI GATC 4 cut(s) 43, 90, 120, 231
MboI GATC 4 cut(s) 41, 88, 118, 229
MboII GAAGA 2 cut(s) 16, 169
MflI RGATCY 2 cut(s) 41, 229
MhlI GDGCHC 1 cut(s) 81
MluCI AATT 4 cut(s) 84, 110, 187, 218
MmeI TCCRAC 1 cut(s) 123
NdeII GATC 4 cut(s) 41, 88, 118, 229
NlaIII CATG 1 cut(s) 269
PfeI GAWTC 1 cut(s) 147
PflFI GACNNNGTC 1 cut(s) 137
PspPI GGNCC 1 cut(s) 262
PsuI RGATCY 2 cut(s) 41, 229
PsyI GACNNNGTC 1 cut(s) 137
Sau3AI GATC 4 cut(s) 41, 88, 118, 229
Sau96I GGNCC 1 cut(s) 262
SduI GDGCHC 1 cut(s) 81
SetI ASST 4 cut(s) 105, 118, 277, 287
SfaNI GCATC 1 cut(s) 161
SinI GGWCC 1 cut(s) 262
Sse9I AATT 4 cut(s) 84, 110, 187, 218
SsiI CCGC 3 cut(s) 32, 142, 196
TasI AATT 4 cut(s) 84, 110, 187, 218
TfiI GAWTC 1 cut(s) 147
TspDTI ATGAA 2 cut(s) 17, 170
TspGWI ACGGA 1 cut(s) 39
Tth111I GACNNNGTC 1 cut(s) 137
VpaK11BI GGWCC 1 cut(s) 262
XapI RAATTY 1 cut(s) 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.