Rh4BG244600

Protein translocase subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Reverse (-)
41176105 .. 41177836
1732 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG244600.1

Sequence Viewer

Length: 159 bp
ATGGAAAGAATGAGAGCCCTTGAATCTAACAATCTGCAATCACTTATAATTGAATATGCTGAACTAACAATGGATGATATCTTAGAGTCGTCAATTATGATAGTGAGGACTGGGAAGGAAGACATTAGAGCCATAACAAGGATGCCCACTCTGCGGTAA

Protein Analysis

52

Amino Acids

6.07

Weight (kDa)

4.89

Isoelectric Point (pI)

61.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 47
AciI CCGC 1 cut(s) 154
AfiI CCNNNNNNNGG 2 cut(s) 138, 153
AgsI TTSAA 2 cut(s) 23, 53
BanII GRGCYC 1 cut(s) 19
BbsI GAAGAC 1 cut(s) 126
BmrI ACTGGG 1 cut(s) 120
BmsI GCATC 1 cut(s) 132
BmuI ACTGGG 1 cut(s) 120
BpiI GAAGAC 1 cut(s) 126
Bsc4I CCNNNNNNNGG 2 cut(s) 138, 153
Bse1I ACTGG 1 cut(s) 115
BseGI GGATG 2 cut(s) 79, 147
BseLI CCNNNNNNNGG 2 cut(s) 138, 153
BseNI ACTGG 1 cut(s) 115
BslI CCNNNNNNNGG 2 cut(s) 138, 153
Bsp1286I GDGCHC 1 cut(s) 19
BspACI CCGC 1 cut(s) 154
BsrI ACTGG 1 cut(s) 115
BstDEI CTNAG 1 cut(s) 82
BstF5I GGATG 2 cut(s) 79, 147
BstMWI GCNNNNNNNGC 1 cut(s) 151
BstV2I GAAGAC 1 cut(s) 126
BtsCI GGATG 2 cut(s) 79, 147
CviJI RGCY 2 cut(s) 17, 131
CviKI_1 RGCY 2 cut(s) 17, 131
DdeI CTNAG 1 cut(s) 82
Eco24I GRGCYC 1 cut(s) 19
Eco32I GATATC 1 cut(s) 79
EcoRV GATATC 1 cut(s) 79
EcoT38I GRGCYC 1 cut(s) 19
FaiI YATR 4 cut(s) 47, 57, 98, 134
FokI GGATG 2 cut(s) 86, 154
FriOI GRGCYC 1 cut(s) 19
HinfI GANTC 2 cut(s) 23, 86
HpyAV CCTTC 1 cut(s) 109
HpyCH4V TGCA 1 cut(s) 37
HpyF10VI GCNNNNNNNGC 1 cut(s) 151
HpyF3I CTNAG 1 cut(s) 82
LpnPI CCDG 1 cut(s) 96
LweI GCATC 1 cut(s) 132
MboII GAAGA 1 cut(s) 131
MhlI GDGCHC 1 cut(s) 19
MluCI AATT 2 cut(s) 48, 93
MlyI GAGTC 1 cut(s) 95
MnlI CCTC 1 cut(s) 99
MwoI GCNNNNNNNGC 1 cut(s) 151
PfeI GAWTC 1 cut(s) 23
PleI GAGTC 1 cut(s) 94
PpsI GAGTC 1 cut(s) 94
PsiI TTATAA 1 cut(s) 47
SchI GAGTC 1 cut(s) 95
SduI GDGCHC 1 cut(s) 19
SfaNI GCATC 1 cut(s) 132
SgeI CNNG 3 cut(s) 32, 123, 150
Sse9I AATT 2 cut(s) 48, 93
SsiI CCGC 1 cut(s) 154
TasI AATT 2 cut(s) 48, 93
TfiI GAWTC 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.