Rh5AG334200

39S ribosomal protein L45

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0011628
Physical Location & Seq
Forward (+)
53540823 .. 53550025
9203 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG334200.1

Sequence Viewer

Length: 393 bp
ATGGCTAAGCCTCTCAGAGTTTCGACGATTCGGTCTGAGTCATTCCATGGGACTCACAAGGTCCCTGTAGTGTTAGAGCCAAGAATGTTCAGCTGGAATATGAACTCAAGCTTAAATAAGAGCCATGGAGCACTTCCTTGGACTTCTAGAAATGATATGATGTTGCATTCTGCAATGGCTGTCGAGTTGCCAATCTTCTTGAATGATAAAAGGTTGCTATCCATACAAGTAAAAGCACCTGCCCAAGCAAGGCAAATGTGTTCTGGGATTGATATGGGATTCCAGAAATTGCAAAACCTTGCTTTCATTTACCAGCTTAAGGAGGCAAAGCTATGGCTTTCCAATGGATCGAATGGAATTGAATTGGCAAAGTATATCCTGGAGCATGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Tim44

Protein Analysis

130

Amino Acids

14.71

Weight (kDa)

9.78

Isoelectric Point (pI)

38.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 247
AasI GACNNNNNNGTC 1 cut(s) 31
Acc36I ACCTGC 1 cut(s) 247
AclWI GGATC 1 cut(s) 355
AfiI CCNNNNNNNGG 2 cut(s) 249, 319
AflII CTTAAG 1 cut(s) 317
AgsI TTSAA 2 cut(s) 202, 362
AjnI CCWGG 1 cut(s) 378
AluBI AGCT 4 cut(s) 93, 111, 316, 331
AluI AGCT 4 cut(s) 93, 111, 316, 331
Alw21I GWGCWC 1 cut(s) 133
AlwI GGATC 1 cut(s) 355
AspS9I GGNCC 1 cut(s) 61
AvaII GGWCC 1 cut(s) 61
Bbv12I GWGCWC 1 cut(s) 133
BciT130I CCWGG 1 cut(s) 380
BfaI CTAG 1 cut(s) 147
BfmI CTRYAG 1 cut(s) 66
BfrI CTTAAG 1 cut(s) 317
BfuAI ACCTGC 1 cut(s) 247
BlpI GCTNAGC 1 cut(s) 6
Bme1390I CCNGG 1 cut(s) 380
Bme18I GGWCC 1 cut(s) 61
BmgT120I GGNCC 1 cut(s) 61
BmiI GGNNCC 1 cut(s) 63
BmrFI CCNGG 1 cut(s) 380
Bpu1102I GCTNAGC 1 cut(s) 6
BpuEI CTTGAG 1 cut(s) 91
BsaJI CCNNGG 3 cut(s) 46, 124, 137
Bsc4I CCNNNNNNNGG 2 cut(s) 249, 319
Bse3DI GCAATG 1 cut(s) 180
BseBI CCWGG 1 cut(s) 380
BseDI CCNNGG 3 cut(s) 46, 124, 137
BseLI CCNNNNNNNGG 2 cut(s) 249, 319
BseMI GCAATG 1 cut(s) 180
BseMII CTCAG 2 cut(s) 27, 28
BsiHKAI GWGCWC 1 cut(s) 133
BslFI GGGAC 2 cut(s) 47, 64
BslI CCNNNNNNNGG 2 cut(s) 249, 319
BsmFI GGGAC 2 cut(s) 47, 64
BsmI GAATGC 1 cut(s) 166
Bsp1286I GDGCHC 1 cut(s) 133
Bsp143I GATC 1 cut(s) 347
Bsp1720I GCTNAGC 1 cut(s) 6
Bsp19I CCATGG 2 cut(s) 46, 124
BspCNI CTCAG 2 cut(s) 27, 28
BspLI GGNNCC 1 cut(s) 63
BspMI ACCTGC 1 cut(s) 247
BspPI GGATC 1 cut(s) 355
BspTI CTTAAG 1 cut(s) 317
BsrDI GCAATG 1 cut(s) 180
BssECI CCNNGG 3 cut(s) 46, 124, 137
BssMI GATC 1 cut(s) 347
BssT1I CCWWGG 3 cut(s) 46, 124, 137
Bst2UI CCWGG 1 cut(s) 380
BstAFI CTTAAG 1 cut(s) 317
BstC8I GCNNGC 1 cut(s) 387
BstDEI CTNAG 4 cut(s) 6, 14, 36, 390
BstDSI CCRYGG 2 cut(s) 46, 124
BstKTI GATC 1 cut(s) 350
BstMBI GATC 1 cut(s) 347
BstNI CCWGG 1 cut(s) 380
BstNSI RCATGY 1 cut(s) 389
BstSCI CCNGG 1 cut(s) 378
BstSFI CTRYAG 1 cut(s) 66
BtgI CCRYGG 2 cut(s) 46, 124
BveI ACCTGC 1 cut(s) 247
Cac8I GCNNGC 1 cut(s) 387
Cfr13I GGNCC 1 cut(s) 61
CviAII CATG 3 cut(s) 47, 125, 386
DdeI CTNAG 4 cut(s) 6, 14, 36, 390
DpnI GATC 1 cut(s) 349
DpnII GATC 1 cut(s) 347
DrdI GACNNNNNNGTC 1 cut(s) 31
DseDI GACNNNNNNGTC 1 cut(s) 31
Eco130I CCWWGG 3 cut(s) 46, 124, 137
Eco47I GGWCC 1 cut(s) 61
EcoO109I RGGNCCY 1 cut(s) 61
EcoRII CCWGG 1 cut(s) 378
EcoT14I CCWWGG 3 cut(s) 46, 124, 137
ErhI CCWWGG 3 cut(s) 46, 124, 137
FaeI CATG 3 cut(s) 50, 128, 389
FaiI YATR 9 cut(s) 48, 101, 126, 158, 224, 275, 334, 375, 387
FaqI GGGAC 2 cut(s) 47, 64
FatI CATG 3 cut(s) 46, 124, 385
FspBI CTAG 1 cut(s) 147
Hin1II CATG 3 cut(s) 50, 128, 389
HindIII AAGCTT 1 cut(s) 109
HinfI GANTC 4 cut(s) 28, 38, 52, 279
Hpy188I TCNGA 2 cut(s) 17, 37
Hpy188III TCNNGA 3 cut(s) 147, 199, 283
Hpy99I CGWCG 1 cut(s) 28
HpyCH4V TGCA 3 cut(s) 166, 173, 292
HpyF3I CTNAG 4 cut(s) 6, 14, 36, 390
Hsp92II CATG 3 cut(s) 50, 128, 389
Kzo9I GATC 1 cut(s) 347
LmnI GCTCC 2 cut(s) 128, 382
LpnPI CCDG 7 cut(s) 78, 79, 249, 252, 296, 326, 365
MaeI CTAG 1 cut(s) 147
MalI GATC 1 cut(s) 349
MboI GATC 1 cut(s) 347
MboII GAAGA 1 cut(s) 187
MhlI GDGCHC 1 cut(s) 133
MluCI AATT 3 cut(s) 287, 357, 362
MlyI GAGTC 2 cut(s) 46, 47
MnlI CCTC 2 cut(s) 21, 316
MseI TTAA 2 cut(s) 113, 318
MspA1I CMGCKG 1 cut(s) 93
MspCI CTTAAG 1 cut(s) 317
MspR9I CCNGG 1 cut(s) 380
Mva1269I GAATGC 1 cut(s) 166
MvaI CCWGG 1 cut(s) 380
NcoI CCATGG 2 cut(s) 46, 124
NdeII GATC 1 cut(s) 347
NlaIII CATG 3 cut(s) 50, 128, 389
NlaIV GGNNCC 1 cut(s) 63
NspI RCATGY 1 cut(s) 389
PaeI GCATGC 1 cut(s) 389
PaqCI CACCTGC 1 cut(s) 247
PctI GAATGC 1 cut(s) 166
PfeI GAWTC 2 cut(s) 28, 279
PfoI TCCNGGA 1 cut(s) 378
PleI GAGTC 2 cut(s) 46, 46
PpsI GAGTC 2 cut(s) 46, 46
PpuMI RGGWCCY 1 cut(s) 61
Psp5II RGGWCCY 1 cut(s) 61
Psp6I CCWGG 1 cut(s) 378
PspGI CCWGG 1 cut(s) 378
PspN4I GGNNCC 1 cut(s) 63
PspPI GGNCC 1 cut(s) 61
PspPPI RGGWCCY 1 cut(s) 61
PvuII CAGCTG 1 cut(s) 93
SaqAI TTAA 2 cut(s) 113, 318
Sau3AI GATC 1 cut(s) 347
Sau96I GGNCC 1 cut(s) 61
SchI GAGTC 2 cut(s) 46, 47
ScrFI CCNGG 1 cut(s) 380
SduI GDGCHC 1 cut(s) 133
SetI ASST 8 cut(s) 63, 95, 113, 215, 241, 300, 318, 333
SfcI CTRYAG 1 cut(s) 66
SinI GGWCC 1 cut(s) 61
SmlI CTYRAG 2 cut(s) 106, 317
SmoI CTYRAG 2 cut(s) 106, 317
SphI GCATGC 1 cut(s) 389
Sse9I AATT 3 cut(s) 287, 357, 362
SspMI CTAG 1 cut(s) 147
StyD4I CCNGG 1 cut(s) 378
StyI CCWWGG 3 cut(s) 46, 124, 137
TaqI TCGA 3 cut(s) 23, 183, 350
TaqII GACCGA 1 cut(s) 21
TasI AATT 3 cut(s) 287, 357, 362
TfiI GAWTC 2 cut(s) 28, 279
Tru1I TTAA 2 cut(s) 113, 318
Tru9I TTAA 2 cut(s) 113, 318
TspDTI ATGAA 2 cut(s) 116, 295
Vha464I CTTAAG 1 cut(s) 317
VpaK11BI GGWCC 1 cut(s) 61
XbaI TCTAGA 1 cut(s) 146
XceI RCATGY 1 cut(s) 389
XspI CTAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.